Solanum lycopersicum mRNA Solyc02g093010.2.1

mRNA details  
Name Type Length
1,088
Organism
Description
RER1 protein (AHRD V1 ***- Q9P0H9_HUMAN); contains Interpro domain(s) IPR004932 Retrieval of early ER protein Rer1
Location(s)
SL2.50ch02:53966406..53969718
Ontology term(s)
GFF source
ITAG_eugene
From BOGAS
1
Interpro2go term
GO:0016021
Length
3313
Nb exon
3
mRNA sequence spliced mRNA sequence, including UTRs 
>Solyc02g093010.2.1 RER1 protein (AHRD V1 ***- Q9P0H9_HUMAN); contains Interpro domain(s) IPR004932 Retrieval of early ER protein Rer1

TAATCATAATTATCTTTTGTGTTTTTTCACTCAGCTGTGAGTGTTAAGTATTTTCAAAATTGAAACAACCCTGCCGTACTTGAAAGAAACACTCTCCAACTCTATGGATATTAATACGGCCGGCGCCGGTGCCGGCGATGTTACTCCATCCGGTGCTTTTTGCCAATGGACTTCATCTGCTTCTCTCTCGTTCCAGCACTTTTTGGATAAAACGACGCCATATTTACTATACCGCTGGATTGCGTTTTTCTTCATCGCTGTCCTGTATGTCGTGCGAGTGTATCTGGTGGAAGGATTCTACGTTATCTCGTATGCCCTGGGAATCTATCTTCTTAACCTCCTCATCGGTTTCCTCTCGCCGCAAGTTGACCCGGAGTTACAGGATTTATCTGATGGCCCGACTCTGCCGACCCGAGAAACCGACGAATTCCGCCCTTTCGTTCGTCGCCTTCCTGAATTCAAATTCTGGTACTCAATTACCAAGGCGTTCTGCATTGCATTTGTGTTAACATTTTTCAGTGTATTGGATGTGCCTGTATTTTGGCCGATTCTCGTTTTCTATTGGGTTGTGCTGTTCACACTTACAATGAGAAGACAAATACGACACATGTTGAAATATAAATATCTGCCATTCTCTTTTGGGAAGCAGCGGTATGATGGAAAGAAAGCAGCTTCATCAGAGAGTGAAGATCTTCTCCCGTAGACTGAAACGTCTGCAGCAGCTGCTTACTCTATGAAATTTACATCATGCTGCTGTTAATTGTCTTTTCTTTTCTGCTTCAATAGCCATAGATTTCTAGGATGCTACTGGGACTGGAAGAAACTCTCAGGAGAATCAGTATCAACGTTATGGTTACATTTTGTCTCGGGGCATATTTTATAGTGTAATGATATCTTTGTTTTCCATTTGCACAGCTTTCAGAAAATTATGCTTTATAAATACCCTGATGTATTATAGTACCTTTACTTGGTTTCTACCTATGTAAAGAAGCTTGCCAGTGCTCTTGTTAGTAATCTGCTGGCTTCTACTATGCCAGAAGCCTCTCTGTGGAGCAAATAAAGAGTTGAATGTAGTTAGTAAACAGTAA
Genomic sequence(s) unprocessed genomic sequence underlying each location of this mRNA 
Related features  
Features that derive from this mRNA 
TypeNameLocationLengthStrandPhase
polypeptideSolyc02g093010.2.1SL2.50ch02:53966508..53969333200+n/a
Add items to a list:

Features this mRNA is a part of 
TypeNameLocationLengthStrandPhase
geneSolyc02g093010.2SL2.50ch02:53966406..539697183,313+n/a
Add items to a list:

Features that are parts of this mRNA 
TypeNameLocationLengthStrandPhase
exonexon:Solyc02g093010.2.1.1SL2.50ch02:53966406..53966873468+n/a
exonexon:Solyc02g093010.2.1.2SL2.50ch02:53968988..53969168181+n/a
exonexon:Solyc02g093010.2.1.3SL2.50ch02:53969280..53969718439+1
intronintron:Solyc02g093010.2.1.1SL2.50ch02:53966874..53968987n/a+n/a
intronintron:Solyc02g093010.2.1.2SL2.50ch02:53969169..53969279n/a+n/a
Add items to a list:

Related viewsNone found
http%3A%2F%2Fwww.sgn.cornell.edu%3A8080%2Ffeature%2F17745498%2Fdetails feature 17745498
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)