Solanum lycopersicum mRNA Solyc03g117020.2.1

mRNA details  
Name Type Length
1,415
Organism
Description
Stromal cell-derived factor 2 (AHRD V1 *--- B6TVP8_MAIZE); contains Interpro domain(s) IPR003608 MIR
Location(s)
SL2.50ch03:66287681..66292507
Ontology term(s)
GFF source
ITAG_eugene
From BOGAS
1
Interpro2go term
GO:0016020
Length
4827
Nb exon
7
mRNA sequence spliced mRNA sequence, including UTRs 
>Solyc03g117020.2.1 Stromal cell-derived factor 2 (AHRD V1 *--- B6TVP8_MAIZE); contains Interpro domain(s) IPR003608 MIR

ATGTTTTTGCCGGTAAATTTCGGTAAGAAAACAACTATCGTGTTCCAATCAGAAGTAGCCAGGTCACCAAAAGTCCACGTGGAGAAAACTGATTTGCTCAGGCTGCTCCTCCAACGTGGAATCTGGAACGTAAAAAGCCTCCTGCATCCGAAGCCCAAGCCAAAAAGCCCACAGCGACCATCAAATATCATCGGAGATTGGAAAGTAGGAAATTGTTTGAAATTTCACATCCGAATCGGAACATCGTCGGAGCTCCATCGGGCATCCGCAAAGAGCTTCATCGTGGCTCCCTCAGGGTTACAACAACATCAAACTCTTACTAGAAGGAAATCAGCACCGCCGTCGACATTGAATCAAGCCGGTGCATCGGGCTCGAAGCGAATAGTGCTGAAAGAATCCTCATCCGAATCGGACCTTGATCTTCCATTTTGGCAAAGAACCTGGTTCATTGTTCTCTTACTTCTCATGGCGATTTCCTTCTTCGGCCTAGCGCTTTTTCTTTTTCTCACCCTGGACTCTGATTACATATCAACAACACCTGTCTCCGCTGCTTCCGAAGGCGTCCAGATTACATATGGATCCGCGATTAAGTTGATGCACGAGAAGACAAAGTTTCGGTTGCATTCCCATGATGTGCCATATGGTTCTGGCAGTGGGCAGCAATCAGTCACTGGATTTCCCGGCGTAGATGATGCTAACAGCTACTGGGCTGTTAGGAGCACCGACTCGTCCAAGCAAGGTGATCCTATAAAGAGTGGAAGCATCATCAGGCTGCAACATATAAAGACAAGAAGATGGTTACATAGCCATTTGCATGCTTCTCCCATATCAGGAAATATGGAGGTCAGCTGCTTCGGTGATGACAAGGAATCTGATACAGGGGACTATTGGAGACTTGAAATTGAGGGCAGTGGGAAAACTTGGAGGCAAGACCAAAGAATCAGGCTTCAACACGTGGACACTGGTGGTTATCTCCACAGTCATGACAAGAAATACACCCGAATTGCTGGAGGTCAGCAAGAGGTTTGCGGTGTTAAAGAAAAACGTCCAGATAATGTTTGGTTGGCAGCAGAGGGTGTCTACTTCCCAGTTACTGAAAAAAGCAAGTAAAGATTGTTGATAACAGTATGTTAGCTGAATTTTATCTGTAGAGACATATTAGTTACTAATGTACCAAAACCTTTTCTAGTACTTTGAGCTGTTGTTAGCATTTTCACTGTTGCAAATGGTAACAATTGGTTGATAATTCTTCGCTGCTCGGTTTCCTTGTTACTTCCCTCAGGTGAGGATGATTCTGGTTCAATTATAAAGAAATAGTTAAAATGTTAGCCATTCTTCTAATTTCATAGCACTTCTGAATCAGTGTTATATTGTAGTTATATAGTTTCCATATTAAGAATAAAGCTTGCATTGCT
Genomic sequence(s) unprocessed genomic sequence underlying each location of this mRNA 
Related features  
Features that derive from this mRNA 
TypeNameLocationLengthStrandPhase
polypeptideSolyc03g117020.2.1SL2.50ch03:66287680..66292202370+n/a
Add items to a list:

Features this mRNA is a part of 
TypeNameLocationLengthStrandPhase
geneSolyc03g117020.2SL2.50ch03:66287681..662925074,827+n/a
Add items to a list:

Features that are parts of this mRNA 
TypeNameLocationLengthStrandPhase
exonexon:Solyc03g117020.2.1.1SL2.50ch03:66287681..6628770929+n/a
exonexon:Solyc03g117020.2.1.2SL2.50ch03:66287757..66288294538+1
exonexon:Solyc03g117020.2.1.3SL2.50ch03:66288484..66288624141+n/a
exonexon:Solyc03g117020.2.1.4SL2.50ch03:66288719..66288853135+n/a
exonexon:Solyc03g117020.2.1.5SL2.50ch03:66291721..6629177050+n/a
exonexon:Solyc03g117020.2.1.6SL2.50ch03:66291882..66292011130+1
exonexon:Solyc03g117020.2.1.7SL2.50ch03:66292116..66292507392+n/a
intronintron:Solyc03g117020.2.1.1SL2.50ch03:66287710..66287756n/a+n/a
intronintron:Solyc03g117020.2.1.2SL2.50ch03:66288295..66288483n/a+n/a
intronintron:Solyc03g117020.2.1.3SL2.50ch03:66288625..66288718n/a+n/a
intronintron:Solyc03g117020.2.1.4SL2.50ch03:66288854..66291720n/a+n/a
intronintron:Solyc03g117020.2.1.5SL2.50ch03:66291771..66291881n/a+n/a
intronintron:Solyc03g117020.2.1.6SL2.50ch03:66292012..66292115n/a+n/a
Add items to a list:

Related viewsNone found
http%3A%2F%2Fwww.sgn.cornell.edu%3A8080%2Ffeature%2F17775305%2Fdetails feature 17775305
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)