Solanum lycopersicum mRNA Solyc05g055160.2.1

mRNA details  
Name Type Length
1,597
Organism
Description
DNAJ chaperone (AHRD V1 ***- B0W7V8_CULQU); contains Interpro domain(s) IPR003095 Heat shock protein DnaJ
Location(s)
SL2.50ch05:64922771..64927161
Ontology term(s)
GFF source
ITAG_eugene
From BOGAS
1
Interpro2go term
  • GO:0006457
  • GO:0031072
Length
4391
Nb exon
8
Sifter term
GO:0050750
mRNA sequence spliced mRNA sequence, including UTRs 
>Solyc05g055160.2.1 DNAJ chaperone (AHRD V1 ***- B0W7V8_CULQU); contains Interpro domain(s) IPR003095 Heat shock protein DnaJ

TGACCGTTCAATTCTCAACCTCACAATAAAACCACAGATCTCATACTCAAAGCAAACCCTCTCTCCCTTTTCCTCCATACTCGAACAAGCCAACAAACTCTTCTTCTCGCCGCGCTTTATCATCGTTCAATTTTGACTAAATTAAGCGATCGAAGATGTTTGGGAGGGCACCGAAAAAGAGCGACAACACGAAGTACTATGAAATCTTAGGTGTTCCTAAAACTGCTGCACAAGAAGATCTCAAGAAAGCTTACCGTAAAGCTGCTATTAAGAATCATCCTGATAAGGGAGGTGATCCTGAAAAGTTTAAAGAGCTTGCACAAGCTTATGAGGTTCTGAGTGATCCCGAGAAGCGTGAGATATATGATCAGTATGGAGAAGATGCTCTCAAGGAAGGAATGGGCGGTGGAGGTGGTGGACACGACCCATTTGATATTTTCTCATCTTTCTTTGGTGGCAGCCCATTTGGTGGAGGTGGTGGAAGCAGCAGAGGAAGAAGACAAAGAAGAGGAGAGGATGTTGTCCACCCTCTCAAAGTTTCTCTGGAGGATCTGTACAATGGAACATCAAAGAAGCTTTCACTATCTCGCAATGTATTGTGCCCGAAGTGCAAGGGGAAAGGATCTAAATCAGGTGCTTCAATGAAGTGTTCTGGCTGTCAAGGGTCTGGAATGAAAGTCACTATTAGACAACTTGGCCCATCCATGATCCAGCAGATGCAGCACCCTTGCAACGAGTGTAAGGGTACTGGTGAGATGATCAATGATAAAGATAGGTGTGGGCAGTGTAAAGGTGAGAAGGTTGTGCAGGAGAAGAAGGTGTTGGAAGTTGTTGTCGAGAAGGGTATGCAGAATGGACAGAAGATCACATTCCCGGGCGAGGCTGATGAAGCACCTGATACCGTCACTGGGGACATAGTTTTTGTCTTGCAACAGAAGGAACATCCCAAGTTTAAGCGGAAGGGAGATGATCTCTTTGTAGAGCACACCTTGAGCTTAACCGAGGCCCTGTGTGGTTTCCAGTTCATCTTGACTCACCTAGATACCAGGCAGCTGATCATCAAGTCCCAACCCGGAGAAGTTGTCAAACCTGATCAATTTAAGGCCATAAATGATGAAGGAATGCCGATGTACCAAAGGCCATTTATGAGAGGAAAACTATACATTCACTTCACCGTAGAATTCCCCGACACATTATCCCTCGAGCAATGCAAGAACCTTGAAGCAGTATTGCCACCAAAACCCAAAACCCAAATGACTGATATGGAATTGGACGAGTGCGAGGAGACCACGTTACATGATGTTAACATCGAAGAGGAGATGCGTAGGAAGCAGCAACAGGCCCAAGAGGCATACGACGAAGACGATGAAGACATGCATGGTGGTGCACAGAGAGTTCAATGTGCACAACAGTAATTTGGTAACACGGAATTAACGTCACGATTCAACTCTTGTTTTCACGTATTTGTAATGACATTACTAGCTTATAAATTTCGAGTTTTGAATTTGCTAATCTATACTGTTAACGTTACAAACATATTATTGAAATATTTTGTCGAAGAATTGATATAAAGAGGAAATAAATTGGTGTAGATCAT
Genomic sequence(s) unprocessed genomic sequence underlying each location of this mRNA 
Related features  
Features that derive from this mRNA 
TypeNameLocationLengthStrandPhase
polypeptideSolyc05g055160.2.1SL2.50ch05:64923130..64926148420-n/a
Add items to a list:

Features this mRNA is a part of 
TypeNameLocationLengthStrandPhase
geneSolyc05g055160.2SL2.50ch05:64922771..649271614,391-n/a
Add items to a list:

Features that are parts of this mRNA 
TypeNameLocationLengthStrandPhase
exonexon:Solyc05g055160.2.1.1SL2.50ch05:64927037..64927161125-n/a
exonexon:Solyc05g055160.2.1.2SL2.50ch05:64925999..64926178180-n/a
exonexon:Solyc05g055160.2.1.3SL2.50ch05:64924569..64924734166-2
exonexon:Solyc05g055160.2.1.4SL2.50ch05:64924332..64924476145-1
exonexon:Solyc05g055160.2.1.5SL2.50ch05:64923945..64924221277-n/a
exonexon:Solyc05g055160.2.1.6SL2.50ch05:64923622..64923820199-2
exonexon:Solyc05g055160.2.1.7SL2.50ch05:64922956..64923453498-n/a
exonexon:Solyc05g055160.2.1.8SL2.50ch05:64922771..649227777-n/a
intronintron:Solyc05g055160.2.1.2SL2.50ch05:64926179..64927036n/a-n/a
intronintron:Solyc05g055160.2.1.3SL2.50ch05:64924735..64925998n/a-n/a
intronintron:Solyc05g055160.2.1.4SL2.50ch05:64924477..64924568n/a-n/a
intronintron:Solyc05g055160.2.1.5SL2.50ch05:64924222..64924331n/a-n/a
intronintron:Solyc05g055160.2.1.6SL2.50ch05:64923821..64923944n/a-n/a
intronintron:Solyc05g055160.2.1.7SL2.50ch05:64923454..64923621n/a-n/a
intronintron:Solyc05g055160.2.1.8SL2.50ch05:64922778..64922955n/a-n/a
Add items to a list:

Related viewsNone found
http%3A%2F%2Fwww.sgn.cornell.edu%3A8080%2Ffeature%2F17834099%2Fdetails feature 17834099
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)