Solanum lycopersicum mRNA Solyc06g072280.2.1

mRNA details  
Name Type Length
577
Organism
Description
Small nuclear ribonucleoprotein E (AHRD V1 ***- B6SK95_MAIZE); contains Interpro domain(s) IPR006649 Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core
Location(s)
SL2.50ch06:44564152..44566407
Ontology term(s)
GFF source
ITAG_eugene
From BOGAS
1
Length
2256
Nb exon
6
Sifter term
GO:0005515
mRNA sequence spliced mRNA sequence, including UTRs 
>Solyc06g072280.2.1 Small nuclear ribonucleoprotein E (AHRD V1 ***- B6SK95_MAIZE); contains Interpro domain(s) IPR006649 Like-Sm ribonucleoprotein, eukaryotic and archaea-type, core

ATGGCTAGCACCAAAGTACAGAGGATTATGACCCAGCCCATTAATCTGATCTTCAGATTTCTTCAGAGTAAAGCTCGCATTCAGATATGGCTATTTGAGCAGAAGGATCAGAGGATTGAAGGACGTATTATTGGTTTTGATGAGTACATGAATTTGGTTCTAGATGATGCCGAGGAAGTCAATGTGAAGAAGAATAGCAGAAAGCAGTTAGGGCGGATTCTTCTGAAAGGAGATAATATCACATTGATGATGAACACGGGGAAATGATTTCCTGTTAGCTGGATCTTGAGAAGAAGTTCAATTTTCTGGCAAAAATCAACTATTGGAATGTCGTCTTTGTGGACAAGAAGCTGGATGTTAGATGCACATGATTGAGTTTGAACTTCCATTTATGTTTTGATATATGTATATTCAGCATGGTATGCTCAGATCTCTTTATACAGTGAAGAAGAGTAGCCTTATGACCATTTCTCTCTATGTTGGTAGTAACAATTATATCGCAGGTAAAGAATTGTGTTAACTCGAGAAATCAAGTGTTACTATGGATTTTTCATGTCTAATATGCTTTTTTAGGGTG
Genomic sequence(s) unprocessed genomic sequence underlying each location of this mRNA 
Related features  
Features that derive from this mRNA 
TypeNameLocationLengthStrandPhase
polypeptideSolyc06g072280.2.1SL2.50ch06:44564151..4456609789+n/a
Add items to a list:

Features this mRNA is a part of 
TypeNameLocationLengthStrandPhase
geneSolyc06g072280.2SL2.50ch06:44564152..445664072,256+n/a
Add items to a list:

Features that are parts of this mRNA 
TypeNameLocationLengthStrandPhase
exonexon:Solyc06g072280.2.1.1SL2.50ch06:44564152..4456419342+n/a
exonexon:Solyc06g072280.2.1.2SL2.50ch06:44564292..4456431827+n/a
exonexon:Solyc06g072280.2.1.3SL2.50ch06:44564440..4456450263+n/a
exonexon:Solyc06g072280.2.1.4SL2.50ch06:44565694..4456577279+n/a
exonexon:Solyc06g072280.2.1.5SL2.50ch06:44565888..4456593346+2
exonexon:Solyc06g072280.2.1.6SL2.50ch06:44566088..44566407320+1
intronintron:Solyc06g072280.2.1.1SL2.50ch06:44564194..44564291n/a+n/a
intronintron:Solyc06g072280.2.1.2SL2.50ch06:44564319..44564439n/a+n/a
intronintron:Solyc06g072280.2.1.3SL2.50ch06:44564503..44565693n/a+n/a
intronintron:Solyc06g072280.2.1.4SL2.50ch06:44565773..44565887n/a+n/a
intronintron:Solyc06g072280.2.1.5SL2.50ch06:44565934..44566087n/a+n/a
Add items to a list:

Related viewsNone found
http%3A%2F%2Fwww.sgn.cornell.edu%3A8080%2Ffeature%2F17857396%2Fdetails feature 17857396
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)