Solanum lycopersicum mRNA Solyc07g005330.2.1

mRNA details  
Name Type Length
1,691
Organism
Description
Glucan endo-1 3-beta-glucosidase (AHRD V1 ***- B6U1F1_MAIZE); contains Interpro domain(s) IPR000490 Glycoside hydrolase, family 17
Location(s)
SL2.50ch07:261349..264657
Ontology term(s)
GFF source
ITAG_eugene
From BOGAS
1
Interpro2go term
GO:0005975
Length
3309
Nb exon
3
mRNA sequence spliced mRNA sequence, including UTRs 
>Solyc07g005330.2.1 Glucan endo-1 3-beta-glucosidase (AHRD V1 ***- B6U1F1_MAIZE); contains Interpro domain(s) IPR000490 Glycoside hydrolase, family 17

AACATATGTATCAAAAATACTAAATAGCCCTCTTATTCACAAAAGAAATCTAGAGGTCTCTATTCTCTTTCCTTTTGGTCAAAATAGTCCAAATTTCAAATTGGACTATTCTTCTTCATATATATAAATAAATCATCTATCTCTGCATCAACCATATCAACCATGATAAGCAAAACTTCTTTTGTGCTATTTCTCATTGCTATTGCTCTTTTTCTTCATGATGTAACTTCTATAGGTGTTAATTACGGGACTCTCGGAAACAACCTCCCTCCGCCAGCTCAAGTGGCTCAGTTCATCAAGGATAAAACGGTCATAGACCGTGTAAAGATTTTCGATATCAACCCTGACATCCTCCGTGCTTTTGCAAACACAGGAATCTCGCTAACAGTCACAGTACCAAACGGCGAGATCCCGAATCTACTGGATCTCGCCTATGCTCGACGATACGTCGAGCAGAATATCAAACCTCATTACCCACAGACAAAGATGGATGTTATTCTAGTGGGTAATGAGGTTCTTCACTGGGATACACCTGAGGTACAGAACAAGCTTGTTCCAGCTATGAAAGTTTTTTACCAAGCTTTGGGTTTATCTGGGTTGAAGGGTATAAAAGTCTCTTCAGCTCATTCGTTGGGTATTCTACTCCGTTCTAACCCACCCAGTGCAGCCCGGTTTCGACCCGGTTGGGATGTGGGTATTCTAGCTCCGATGCTACAATTTCTTCGTGAAACAAAAGGTCCTTTCATGGTAAATCCCTATCCCTACTTCGGATACAACAAGAAACAAGAGGATTTTCTTCTATTTAGAAAGAATAAAGGGGTTTACGATAGATTTTCGAAGAAATGGTATACGAATTCTTTTGATATGTTGTTGGATGCGGTGTATATGTCGATGGTGAGATTGAAGCATTCAGATGTGGAGATTGTTGCTGCTGAGACAGGGTGGCCTTCGCAAGGAGAAGCGTATGAACCGCAATGTACTGTGGAAAATGCAGCTTCGTATAATGGTGGATTGATGAAGAAATATAATTCCGGGATCGGTACGCCATTGATGCCGCACAGGAAGATCGAGACCTACATTTTTTCATTGTTCAATGAGAACACCAAACCCGGATCCATCGCTGAGAGGAACTTCGGGTTGTTCCGACCCGATTTCACTCCGGTTTATGATGTCGGAGTTTTGAAAAGCAACCAGGCTCACCCAACACCTTCATTGCCCCCACCAAAAACCGGTGGCGGAGGCAATAAAGGTCAACCAAAAACACCAGCAGAGAACAAAAAATTCTGCATGCCAAAGGTTGAGGCAACTGATGCACAACTACAATCCAACATTAACTATGTGTGCAGTCAGGGAGTTGACTGCACACCAATTCAAGTGGGTGGTTCCTGCTTTAAACCCAACACTATCCGATCTCACGCAGCCTTTGCCATGAACTCGTACTATCAAAAGGAAGGTCGAAACAACTTCAATTGTGACTTTGCTGGTACTGGTGTAGTCGCCTTCTCCGATCCAAGTTATGGAACATGCAAATTTGAATCTTGAATGTACGTGAAGCTAAGGATGATAGCTAGTATTGACTTGTAATATTTATGAATGTTATGTACTTTGGTTTCACATATATAATCTAATTGTATTGGTTTGGTATGTAAACGTTCTTTTTATATACTATGTCATTTAATGTGCCTCATTTA
Genomic sequence(s) unprocessed genomic sequence underlying each location of this mRNA 
Related features  
Features that derive from this mRNA 
TypeNameLocationLengthStrandPhase
polypeptideSolyc07g005330.2.1SL2.50ch07:261497..264495460-n/a
Add items to a list:

Features this mRNA is a part of 
TypeNameLocationLengthStrandPhase
geneSolyc07g005330.2SL2.50ch07:261349..2646573,309-n/a
Add items to a list:

Features that are parts of this mRNA 
TypeNameLocationLengthStrandPhase
exonexon:Solyc07g005330.2.1.1SL2.50ch07:263464..2646571,194-n/a
exonexon:Solyc07g005330.2.1.2SL2.50ch07:261627..261945319-2
exonexon:Solyc07g005330.2.1.3SL2.50ch07:261349..261526178-n/a
intronintron:Solyc07g005330.2.1.2SL2.50ch07:261946..263463n/a-n/a
intronintron:Solyc07g005330.2.1.3SL2.50ch07:261527..261626n/a-n/a
Add items to a list:

Related viewsNone found
http%3A%2F%2Fwww.sgn.cornell.edu%3A8080%2Ffeature%2F17866331%2Fdetails feature 17866331
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)