Solanum lycopersicum mRNA Solyc11g040340.1.1

mRNA details  
Name Type Organism
Synonyms / aliases
mRNA:Solyc11g040340.1.1
Length
1,440
  
Description
Endoglucanase 1 (AHRD V1 ***- B6U0P7_MAIZE); contains Interpro domain(s) IPR008928 Six-hairpin glycosidase-like IPR012341 Six-hairpin glycosidase IPR018221 Glycoside hydrolase, family 9, active site IPR001701 Glycoside hydrolase, family 9
Location(s)
SL2.50ch11:37862898..37865065
Ontology term(s)
GFF source
ITAG_eugene
From BOGAS
1
Interpro2go term
  • GO:0005975
  • GO:0003824
Length
2168
Nb exon
5
Sifter term
GO:0004553
mRNA sequence spliced mRNA sequence, including UTRs 
>Solyc11g040340.1.1 Endoglucanase 1 (AHRD V1 ***- B6U0P7_MAIZE); contains Interpro domain(s) IPR008928 Six-hairpin glycosidase-like IPR012341 Six-hairpin glycosidase IPR018221 Glycoside hydrolase, family 9, active site IPR001701 Glycoside hydrolase, family 9

ATGAAAGTTTGTGTTTGCCTCATTCTCTTCTTCTCTTTGGGTACTGCCCAATTTGACTATAGAGATGCTCTTGAAAAGTCCATTTTGTTCTTTGAAGGACAAAGATCAGGCAAACTCCCCCCCAACCAACGACTCTCTTGGAGGGGTAACTCTGGACTTCAAGATGGTTCACTTGCTAAAGTGGATTTAAGTGGAGGGTATTATGATGCTGGTGATAATGTCAAGTTCAATTTCCCAATGGCATATACGACGACAATGCTGTCGTGGAACACACTTGAGTATGGGAAGAGAATGGGTGCACAATTACAGCATGCACGGGCTGCTATCCGTTGGGCCACTGATTACTTTCTAAAATGTGCAAATGCTGCTCCAAACAAGCTATTCGTTGGTGTTGGTGACCCAAATGCTGATCACAAGTGTTGGGAAAGGCCTGAAGATATGGACACTATACGTAGCGTCTATTATGTGTCTCCCAGTAATCCTGGTTCTGATGTTGCTGGAGAAATGGCTGCTGCTTTAGCTGCTGCCTCATTAGTTTTCCGATCTGTTGATCCAGTTTACTCGAAAAAACTATTGGGAAATGCAGTCAAAGTGTTTAGGTTTGCAGTTCAATACAGAGGGTCTTATAGTGATTCATTAGGCTCTGCAGCTTGCCCATTTTATTGCTCATACTCTGGTTATAAGGATGAGCTATATTGGGGAGCAGCATGGCTATTGAGAGCAACAAATGACATTTCTTACTTAAACTTGATTAATACATTGGGAGCTAATGATGTACCAGATTTATTCAGCTGGGACAACAAGTATGCTGGTGCTCATGTTCTTATGTCAAGGAGAAGCGTGGTAGGAAATGACAATAGATTTGATTCATTCAAACAAAGAGCGGAAGATTTTGTATGTAAAGTACTACCCAACTCACCTTATACAAGCACCCAATATACAAAAGGGGGCTTACTTTACAAGCTACCTGAAGAAAACCTTCAGTATGTGACATCCATTACTTCTCTGCTCACCACTTATGCCAAATACATGGCAACTAAAAAGCATACTTTCAACTGTGGAAGCCTTGTCGTTACAGAAAAGACAATTAGAAACTTTGCAAAAAGACAGGTGGACTATATTTTGGGAAATAATCCAATGAAAATGTCATACATGGTTGGGTATGGGAGTAACTACCCGCGAAGAATTCACCATAGAGGATCATCTTTACCTTCTTTGGCAATGCATCCACAATCATTTGGTTGTGAAGCTGGATTTCAACCATTTTACTACACAGCAAATCCTAACCCTAACATATTAGTTGGAGCTATTATCGGAGGTCCAAATCAAAATGATTTCTTCCCAGATGAACGTACTGATTATAGTCATTCGGAGCCAGCTACTTACATTAATGCTGCTATTGTTGGACCTTTAGCATATTTTGATAGTTCCAAACATTAA
Genomic sequence(s) unprocessed genomic sequence underlying each location of this mRNA 
Related features  
Features that derive from this mRNA 
TypeNameLocationLengthStrandPhase
polypeptideSolyc11g040340.1.1SL2.50ch11:37862897..37865065480+n/a
Add items to a list:

Features this mRNA is a part of 
TypeNameLocationLengthStrandPhase
geneSolyc11g040340.1SL2.50ch11:37862898..378650652,168+n/a
Add items to a list:

Features that are parts of this mRNA 
TypeNameLocationLengthStrandPhase
exonexon:Solyc11g040340.1.1.1SL2.50ch11:37862898..37863077180+n/a
exonexon:Solyc11g040340.1.1.2SL2.50ch11:37863237..37863890654+n/a
exonexon:Solyc11g040340.1.1.3SL2.50ch11:37864308..37864419112+n/a
exonexon:Solyc11g040340.1.1.4SL2.50ch11:37864495..37864658164+2
exonexon:Solyc11g040340.1.1.5SL2.50ch11:37864736..37865065330+n/a
intronintron:Solyc11g040340.1.1.2SL2.50ch11:37863078..37863236n/a+n/a
intronintron:Solyc11g040340.1.1.3SL2.50ch11:37863891..37864307n/a+n/a
intronintron:Solyc11g040340.1.1.4SL2.50ch11:37864420..37864494n/a+n/a
intronintron:Solyc11g040340.1.1.5SL2.50ch11:37864659..37864735n/a+n/a
Add items to a list:

Related viewsNone found
http%3A%2F%2Fwww.sgn.cornell.edu%3A8080%2Ffeature%2F17979402%2Fdetails feature 17979402
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)