Solanum lycopersicum mRNA Solyc12g006650.1.1

mRNA details  
Name Type Organism
Synonyms / aliases
mRNA:Solyc12g006650.1.1
Length
1,992
  
Description
Unknown Protein (AHRD V1)
Location(s)
SL2.50ch12:1115147..1119904
GFF source
ITAG_eugene
From BOGAS
1
Length
4758
Nb exon
8
mRNA sequence spliced mRNA sequence, including UTRs 
>Solyc12g006650.1.1 Unknown Protein (AHRD V1)

ATGAACGGCAATCTGGAGATTTCCGTCGACAAGCTTCCGATCAAGCGTTTAGAGTATATTGAAGAACAAGGCGCTGAACGCTTCCCTTCTGATATAGGATACGATGAGAAAACGGTGAATTTGATTAGGAGAATTGATTTTGCGTGGGCAGTGGAAAGAGAAGAGCCAAGTAAGAAGCAGAAGAAAAGCAGTAGTGCTACTTCTTCAAAGGAGACAAGTAGCAGTCAGCCATGGCAATGGCAGAGTTTGGTGGAGAATTTGCGATTGGCTCATCAAGAGCTTCAAGTCATTATCGATCTCATTCACACTGTGGAGGCAAACGATGCAGTGACAGTGGCTGGCATGACCAGGCCAAAGCAATTGCCCAACGAGCATCTGTCAGACCTTGCCGTGTCTATGGCAACCAAGCTGCAATGCTTCCGTCATTTGGGGAAATATTTTAAGCAATCTGCCAAAGCTTTGGAACAACAAGTGGCTAGAGAAGCAAGATTTTATGGTGCTCTTATCAGATTGCAGCAAAATTGGAAGGTTAAATGGCATCGGATGGTTGCTGCTGCTTCTGGAAATGAAGGGTTTTACATTGATTTATTTGACACTTCATTATATGATCCAGCGGTTGCATTTCGCCCATCTTCTGCATCTGTGGTGCGTATTGAGCATGACCCAGCTGGGATGCTGGCTGTGAATTTACCGCCAAATTCCTGCCGGACTCTTCAATTTGAGTTTCTCGGTGCAAGTACACCTGCTGGTGTTATAAAACATAGCAGACTGAGACCAAAGGTGTCTTTTGAGGATTCTTCTGGAGAAACTAAGAGAGAAAAAAGTGATGATGAGCATGTGAGAGAAACTCATTCGACACTCCGTGAAGTTCACCGAGCAATCTTTGATGAGCAGGTGTTTGATTTGGTTAACCGTGAAGCATTTAATCCAGCTTTGGGTGCTGACGTGACAGGAATACAAGAAAACTTGTTACGTTTAAGTATAGGTCAAAGAGCTTCTCTGTCCATTTCACTTGTACCATCTGCTGACGATGGTCAGACAGCTAATGCTGTGGGTGATGAACATCCAGAAACTGCTATTGTGCCTTTTGAATCAGTTGATGCTTCAAAACAAGATGAAGGGAAACTTGACTTGAAAAAGTTGGGGTTTCCCAATCGAATTAGTTTTGAAATTTATTTGCAACAACTTTTTCATGAACATGTGTTTATAAAAGCCAAAAATAGATTATCATCTTTGGGCAAACCTGAAATATCTTCTCAACCTGTGAAAGATGGTCCCAACCTTTTGGGACATTTCTGCGTCTCTCTAGCTCATAGGATCTTCTCAAACAAAGTCCTCGCAGAGCTCGAAAGTCTGGTTAGCAGGGTACCATATGTCCAATTAATATCGCATCCCACTTGGCATTCTCGAACATCATCATGGACGCTTTCCATGGATGTACCCGAGTCAATTCTCCATGCAGGAAGCCTGTCTCACTCATCTGACTATGTAAAGAATGTGAAATTTCACTTTCGTACAAAAGTCATGGTGCGTGATGATTGCATCAGTCTGGAAGGGGAAGGTGCTCCTAATATTGTTGGCCTCTTCAAAGGAAAGCCTGATAGTATTTGCCCTATGAACAGATATGATTGTGACTTGTCAGATCTTCCGATGGTTCTATTGCAGCAGGTTGCCAGCCAGGTGATACGATGGCTTCATGAAGAAGCCCTTATGGTTGGTATCAAAGCAAACCGGGATTTCTTATCCTTGTCATTTGAGCTAGAGCAAGGAGAAACACTCAGTCTCGTGGCACACGTAGACCCTGAAGATATTCAAGGATGTATTTCCTGGTGGTTGGTGATGGGCGATGGATTCTCTGAAGAAAACAAACTTCAAATGGACGTTAACAGTGGTGAATCCGAAACTAGGAAATTCTTAGGTTATTTATCTTTAGAAGTGTTATACTCAACCTTAATGGATATGGTTAGCGTTAGTAGTACTGCAGGCCATTGA
Genomic sequence(s) unprocessed genomic sequence underlying each location of this mRNA 
Related features  
Features that derive from this mRNA 
TypeNameLocationLengthStrandPhase
polypeptideSolyc12g006650.1.1SL2.50ch12:1115146..1119904664+n/a
Add items to a list:

Features this mRNA is a part of 
TypeNameLocationLengthStrandPhase
geneSolyc12g006650.1SL2.50ch12:1115147..11199044,758+n/a
Add items to a list:

Features that are parts of this mRNA 
TypeNameLocationLengthStrandPhase
exonexon:Solyc12g006650.1.1.1SL2.50ch12:1115147..111523589+n/a
exonexon:Solyc12g006650.1.1.2SL2.50ch12:1115335..1115554220+1
exonexon:Solyc12g006650.1.1.3SL2.50ch12:1117003..1117116114+n/a
exonexon:Solyc12g006650.1.1.4SL2.50ch12:1117284..111736986+n/a
exonexon:Solyc12g006650.1.1.5SL2.50ch12:1117492..1117876385+1
exonexon:Solyc12g006650.1.1.6SL2.50ch12:1117986..1118447462+n/a
exonexon:Solyc12g006650.1.1.7SL2.50ch12:1118531..1118842312+n/a
exonexon:Solyc12g006650.1.1.8SL2.50ch12:1119581..1119904324+n/a
intronintron:Solyc12g006650.1.1.1SL2.50ch12:1115236..1115334n/a+n/a
intronintron:Solyc12g006650.1.1.2SL2.50ch12:1115555..1117002n/a+n/a
intronintron:Solyc12g006650.1.1.3SL2.50ch12:1117117..1117283n/a+n/a
intronintron:Solyc12g006650.1.1.4SL2.50ch12:1117370..1117491n/a+n/a
intronintron:Solyc12g006650.1.1.5SL2.50ch12:1117877..1117985n/a+n/a
intronintron:Solyc12g006650.1.1.6SL2.50ch12:1118448..1118530n/a+n/a
intronintron:Solyc12g006650.1.1.7SL2.50ch12:1118843..1119580n/a+n/a
Add items to a list:

Related viewsNone found
http%3A%2F%2Fwww.sgn.cornell.edu%3A8080%2Ffeature%2F17992528%2Fdetails feature 17992528
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)