Arabidopsis thaliana exon exon-auto18077163

Exon details  
Name Type Length
81
Organism
Location(s)
TAIR10ch01:7178120..7178200
GFF source
TAIR10
Related features  
Features this exon is a part of 
TypeNameLocationLengthStrandPhase
mRNAAT1G20693.3TAIR10ch01:7176775..7178820951+n/a
Add items to a list:

Region sequence(s) reference sequence underlying each location of this feature 
>exon-auto18077163 TAIR10ch01:7178120..7178200

GAGAAAGCTCCTTATGTTGCTAAGGCTGAGAAACGCAAGGTTGAATATGAGAAGAACATTAAAGCTTACAACAAGAAACTG
Download sequence region Get flanking sequences on TAIR10ch01
Related viewsNone found
http%3A%2F%2Fwww.sgn.cornell.edu%3A8080%2Ffeature%2F18077163%2Fdetails feature 18077163
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)