Notice: The contact form functionality has been restored. Apologies for any inconvenience.

Arabidopsis thaliana mRNA AT1G51690.2

mRNA details  
Name Type Organism
Synonyms / aliases
ATB, ALPHA, B
Length
2,255
  
Description
protein phosphatase 2A 55 kDa regulatory subunit B alpha isoform
Location(s)
TAIR10ch01:19165974..19170446
GFF source
TAIR10
mRNA sequence spliced mRNA sequence, including UTRs 
>AT1G51690.2 protein phosphatase 2A 55 kDa regulatory subunit B alpha isoform

TTGTGTGATTTTATTTGTTTGTCGAAATCTGGGAATCATCTGATACTCTTCTTCTTCTCCTCCTTCATCGATTTGCTTCAATCATCTATCGGCGACGAGCTCCATCCGGTTTGTCTCCTAATCAGAATCTCTGATTTCCCGATCCGGCTAATTCCTCATCGTCGGATCAATTAGATTATCTTATCCCAAGGAGAGGAGTGTGTGTGAATCGGAGAGAGCGAGAGACAGAGAGAGAGAGAGGGAAATGAACGGTGGTGATGAGGTCGTCGCAGCTTCGGCAGACCCATCTCTGCCTTTGGAATGGAGATTCTCTCAGGTCTTCGGTGAACGAAGCGCTGGTGAAGAAGTTCAAGAAGTTGATATAATCTCAGCGATTGAATTTGATAATTCTGGAAACCATCTTGCTACTGGGGACCGTGGAGGACGTGTTGTTCTTTTCGAGAGAACCGATACCAATAATAGCAGTGGAACCAGAAGAGAGCTTGAAGAAGCTGATTATCCACTGAGGCATCCAGAGTTTCGTTATAAAACAGAGTTTCAGAGTCATGACCCTGAGTTTGATTACCTCAAGAGTTTGGAGATAGAGGAGAAAATTAACAAAATTAGATGGTGTCAAACAGCAAATGGAGCTCTTTTTCTCCTCTCGACCAATGATAAAACCATCAAGTTTTGGAAGGTTCAAGACAAGAAGATCAAGAAAATCTGTGATATGAATTCAGATCCTTCAAGAACTGTAGGAAACGGAACCGTTGCAAGCTCGAGCAATTCAAACATTACAAACTCATGCCTTGTGAATGGAGGAGTATCTGAAGTGAACAACTCCTTATGTAATGACTTCTCATTGCCAGCAGGAGGCATCTCTTCGCTGCGATTACCAGTGGTAACTAGCCATGAGTCGAGCCCTGTGGCTAGATGTCGAAGAGTATATGCTCATGCTCATGATTATCATATTAATTCAATCTCAAATAACAGCGACGGCGAAACATTTATTTCTGCTGATGATTTGCGAATTAATCTTTGGAATCTGGAAATTAGCAATCAAAGTTTCAATATTGTTGATGTCAAGCCTGCGAAAATGGAAGATCTATCTGAGGTTATCACATCAGCAGAATTTCATCCTACCCATTGCAATATGTTAGCCTATAGCAGTTCGAAAGGTTCAATTCGCCTGATTGATCTGCGCCAGTCAGCTTTATGTGATTCACATTCAAAATTGTTTGAGGAACCAGAGCAAGCAGGTCCTAAATCGTTCTTTACTGAGATAATTGCTTCAGTCTCAGACATCAAATTTGCAAAAGAAGGAAGATATCTACTTAGCCGTGACTATATGACACTTAAGTTATGGGACATCAACATGGACGCAGGTCCAGTAGCAACTTTCCAGGTTCATGAATATTTGAAACCAAAGCTCTGTGATTTATATGAAAATGATTCCATCTTTGACAAGTTCGAGTGTTGTATAAGTGGCAATGGCTTGCGAGCAGCTACAGGTTCTTACAGCAATCTGTTCCGTGTGTTTGGTGTTGCCCCCGGAAGTACTGAGACGGCAACCTTAGAAGCAAGCAGAAACCCAATGAGGAGACATGTCCCAATTCCGTCGAGGCCATCCAGAGCACTAAGCAGTATAACGCGTGTCGTAAGTAGAGGATCAGAGAGTCCGGGAGTCGATGGGAATACTAATGCTCTTGATTACACAACAAAGCTGCTGCATCTTGCTTGGCATCCAAACGAGAACTCAATTGCTTGCGCCGCTGCAAATAGCTTGTACATGTACTATGCTTAACTCAATACTCAGCAAAAAAGAAGAAGAAGCAGAAAAGGCGCATTTCCTTGCTCTAGACTCTGTTTTTCTTGGTTCCGTATGGTTTGATTGATGGGGATTGCTATATACATCATCATGATTGTCACTCACACATGATCTGTAATCATCATCGTGGACTTATGGGGGAATGGCATGGGGAGAAGGCAAGCAGTGAAAAACCAATCATTTTCTCTCTTTCTTTTTTTCGTTTTAAGTGTAGAATTTTTCACTTGTGCACTTGGAAACTACTTTACAGGCCAAGAAAAAAGAACAAAGAAAATCCGATTGGAAGAAATCGTGATTTTAGTAAGCTAATCATCTCGTATGACTTTTGGATGGATATAGATTAGATTTTTATAATCTTTCCTGGTCTGTTGTGTAATCATTGTTTTATTGATTCTTTTGTTAAACTTGTTTCTACTTTCTTGACTTCTTAAAATAATACATTTCATCT
Genomic sequence(s) unprocessed genomic sequence underlying each location of this mRNA 
Related features  
Features that derive from this mRNA 
TypeNameLocationLengthStrandPhase
polypeptideAT1G51690.2TAIR10ch01:19166218..19169974512+n/a
Add items to a list:

Features this mRNA is a part of 
TypeNameLocationLengthStrandPhase
geneAT1G51690TAIR10ch01:19164063..191704496,387+n/a
Add items to a list:

Features that are parts of this mRNA 
TypeNameLocationLengthStrandPhase
exonexon-auto18103182TAIR10ch01:19165974..19166329356+n/a
exonexon-auto18103183TAIR10ch01:19166630..19166733104+n/a
exonexon-auto18103184TAIR10ch01:19166823..1916691896+n/a
exonexon-auto18103185TAIR10ch01:19167005..19167124120+n/a
exonexon-auto18103186TAIR10ch01:19167362..19167565204+n/a
exonexon-auto18103187TAIR10ch01:19167961..1916805292+n/a
exonexon-auto18103188TAIR10ch01:19168288..19168406119+n/a
exonexon-auto18103189TAIR10ch01:19168520..19168643124+n/a
exonexon-auto18103190TAIR10ch01:19168934..19169057124+n/a
exonexon-auto18103191TAIR10ch01:19169174..1916924269+n/a
exonexon-auto18103192TAIR10ch01:19169326..1916941792+n/a
exonexon-auto18103193TAIR10ch01:19169516..1916959378+n/a
exonexon-auto18103194TAIR10ch01:19169681..1916974868+n/a
exonexon-auto18103195TAIR10ch01:19169838..19170446609+n/a
Add items to a list:

Related views  
http%3A%2F%2Fwww.sgn.cornell.edu%3A8080%2Ffeature%2F18103180%2Fdetails feature 18103180
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)