Arabidopsis thaliana mRNA AT2G16500.1

mRNA details  
Name Type Organism
Synonyms / aliases
ADC1, ARGDC1, ARGDC, SPE1
Length
2,718
  
Description
arginine decarboxylase 1
Location(s)
TAIR10ch02:7150622..7153339
GFF source
TAIR10
mRNA sequence spliced mRNA sequence, including UTRs 
>AT2G16500.1 arginine decarboxylase 1

ACCATCTCTCTCTTCTTTCACGTCTCTCTTCCCTGAAACTTTCCCGAGAAAATTCTCAATCCTCTATTTTCTCGAGAAAATTCTCATTCTCATTTTCTTTCAGGGAAAAGTTTTGTTGTTGAATACAGATTTGGAAACTTCATTTGTTTTTTTCCGTTTTTAACCAAAATTTTTAAAAAAGCTTTCTTCTGAACGTTAATCGTGGAGAGTTTCGGGTCGGGTCGGGTCGTAAAAGGCGGGTTTCACGGTGGTGATAGATTCACCTCCTGCTTCCTTCTGAGGGGGTTAGCCCCGAGGCTCTTCGCCTCGGCGGGTTTCAAATTCCCCCAAATCTAACAAACTCACAGATTCATTTTCTCCATTTTTTTTGTTTGTTGAAAATTTGAATCCACAAATTTTGAATTCATTTGTAACCGTTCGTTGAAGAAGAAGAAGATGCCTGCTCTAGCTTTTGTTGATACTCCCATCGATACCTTTTCCAGTATCTTTACACCGTCGTCTGTTTCCACCGCCGTTGTTGACGGTTCCTGCCATTGGTCTCCGTCCCTCTCCTCCTCTCTTTACCGTATCGACGGATGGGGAGCTCCGTATTTCGCAGCGAATTCCTCCGGGAACATCTCTGTTCGTCCTCATGGCTCAAACACTTTACCTCACCAAGACATCGATCTGATGAAAGTTGTGAAGAAAGTTACAGATCCGAGTGGTTTAGGATTACAGCTTCCGCTTATTGTTCGTTTCCCTGATGTTCTGAAGAATCGTCTTGAGTGTCTTCAATCCGCGTTTGATTACGCGATTCAGAGTCAAGGATATGATTCTCATTACCAAGGTGTGTATCCTGTGAAATGTAATCAAGATCGGTTTATCATCGAAGATATTGTCGAATTCGGATCCGGTTTTCGATTCGGTTTAGAAGCTGGTTCCAAGCCTGAGATTCTTCTTGCTATGAGTTGTTTGTGTAAAGGTAATCCTGAAGCTTTTCTTGTGTGTAATGGTTTTAAAGACTCTGAGTATATCTCATTGGCTTTGTTTGGGAGGAAACTTGAATTGAATACTGTTATTGTTCTTGAGCAAGAAGAAGAGCTTGATTTGGTTATTGATTTGAGCCAGAAGATGAATGTTAGGCCTGTTATTGGGTTAAGAGCTAAGCTTAGAACTAAACATTCTGGTCATTTTGGTTCTACTTCTGGTGAGAAGGGGAAGTTTGGTTTGACTACGGTTCAGATTCTTCGTGTGGTGAGGAAGCTGAGTCAAGTTGGTATGCTTGATTGTCTCCAGCTTCTGCATTTTCACATTGGTTCACAGATTCCGTCCACGGCTTTGCTTTCCGACGGTGTGGCTGAGGCTGCGCAGCTTTACTGTGAGCTTGTCCGTCTTGGTGCTCATATGAAGGTGATTGATATTGGTGGTGGGTTGGGGATTGATTACGACGGGTCTAAATCGGGGGAGTCGGATCTCTCTGTTGCTTATAGTCTCGAGGAGTATGCTGCAGCTGTTGTGGCTTCGGTTAGGTTTGTTTGTGATCAGAAGTCTGTGAAGCATCCGGTGATTTGCAGCGAGAGCGGTCGAGCCATTGTGTCTCATCACTCGGTGTTGATCTTTGAAGCTGTCTCAGCTGGTCAACAACATGAGACCCCTACTGATCATCAGTTTATGCTTGAAGGGTACTCTGAGGAAGTTCGAGGTGATTACGAGAATCTTTATGGTGCTGCTATGCGTGGTGATCGTGAAAGCTGCTTGCTTTATGTTGATCAGCTGAAGCAGAGATGTGTTGAAGGGTTCAAAGAAGGTTCCTTGGGCATTGAACAGTTAGCTGGTGTTGATGGATTATGCGAGTGGGTGATTAAGGCGATTGGTGCATCGGATCCGGTTCTTACTTACCATGTCAATCTATCGGTTTTCACTTCGATTCCTGATTTCTGGGGGATTGATCAGCTGTTTCCTATTGTTCCAATCCATAAACTTGACCAAAGGCCTGCCGCGAGAGGGATCTTATCGGATTTGACGTGTGACAGCGACGGAAAGATCAACAAGTTCATAGGCGGAGAATCGAGCTTGCCATTGCACGAGATGGACAACAATGGCTGCAGCGGTGGGCGGTACTATTTGGGAATGTTCCTAGGTGGAGCTTATGAGGAAGCTCTCGGTGGAGTCCACAATCTGTTCGGTGGACCAAGCGTGGTTCGCGTATTGCAGAGCGATGGACCTCACGGATTCGCAGTGACCCGTGCTGTGATGGGCCAATCCTCTGCAGATGTCCTCAGAGCAATGCAGCATGAGCCTGAGCTCATGTTTCAGACTCTTAAACACCGAGCCGAGGAGCCGAGGAACAACAACAACAAAGCTTGTGGTGATAAGGGGAACGACAAACTAGTAGTCGCATCGTGTCTTGCTAAGTCATTCAACAACATGCCTTATCTTTCCATGGAAACGTCAACAAACGCTCTCACCGCAGCGGTCAATAACCTTGGCGTTTACTACTGCGATGAAGCTGCAGCTGGTGGCGGCGGCAAGGGCAAAGATGAGAATTGGTCTTATTTCGGTTGATTGAGAGAGACTTGACAACATCCTCTGTCTTTGATCTTCACCGTACGATTGATTACGATCCTAGTTCTTATTTGTCTTTAAGTTCAGTTTTAAAGTTTTAAGTTATTTTCTTGTAATAAGACAAACTCTTAGCAAAATTTAATAATATTATCATTTATCATCATTCACTAAATT
Genomic sequence(s) unprocessed genomic sequence underlying each location of this mRNA 
Related features  
Features that derive from this mRNA 
TypeNameLocationLengthStrandPhase
polypeptideAT2G16500.1TAIR10ch02:7150796..7152904702-n/a
Add items to a list:

Features this mRNA is a part of 
TypeNameLocationLengthStrandPhase
geneAT2G16500TAIR10ch02:7150622..71533392,718-n/a
Add items to a list:

Features that are parts of this mRNA 
TypeNameLocationLengthStrandPhase
exonexon-auto18149845TAIR10ch02:7150622..71533392,718-n/a
Add items to a list:

Related views  
http%3A%2F%2Fwww.sgn.cornell.edu%3A8080%2Ffeature%2F18149843%2Fdetails feature 18149843
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)