Notice: The contact form functionality has been restored. Apologies for any inconvenience.

Arabidopsis thaliana mRNA AT3G60570.1

mRNA details  
Name Type Organism
Synonyms / aliases
ATEXPB5, EXPB5, ATHEXP, BETA, 1.3
Length
759
  
Description
expansin B5
Location(s)
TAIR10ch03:22391247..22392463
GFF source
TAIR10
mRNA sequence spliced mRNA sequence, including UTRs 
>AT3G60570.1 expansin B5

ATGGCTTCCTCATCTCTCAAATGTTTTTCTTTTATCGTTGTTCTTACAACTTTCTTTGCAATCTCATTGAAGCCATGTTATTGCCACAATAAAACCCACTGGAACACCGCCGGCATCACGTGGTATGGCGACCGAGAAGGTCCTGGCACCACAGGAGGAGCTTGTGGATATGGTGATGCAGTGGCAAAACACCCGTACAGATGTATGGTTTCAGCCGGAGGACCTTCATTGTTCAAAGACGGAAAGGGTTGTGGGGCTTGTTACAGGCTTAAATGCGACCATCCGTTGTGCACGAAAAAGCCGATCAAGGTGATGATATCGGATGAGTGTCCCGGCTGCACGAAGGAGTCTGTCCATTTTGATCTTAGCGGTAAGGCCTTTGGTGCATTGGCCAAACGTGGCAAGGGAGATCAACTACGCAACCTTGGAGAACTAAAAACTATGATCGCTATCCATGTCGACGCCGGAGCAAATCCTTACTACATGTCATTCGCGGTTAAGTTTGCAAACGGTGATGGGAACTTCGCCTGCATTGAGGTCCAACCGGCCGGAGGACAGTATATGAAAATGGAGGAAATGAGATCCGCTGTTTGGAGACTAAGCCCTGGTGTTCCTTTGAAAGGTCCGTTCAACATCAGGCTTACCTCCGCCGTGTCCGGTAAGAAGATCATTGCGAAAGGCGTTATCCCGGAAAAGTGGAGTCCTGGTGCTATTTACCATTCTAAGGTTAACTTCCCCGTTCAAAGGAAGCAGAAATGA
Genomic sequence(s) unprocessed genomic sequence underlying each location of this mRNA 
Related features  
Features that derive from this mRNA 
TypeNameLocationLengthStrandPhase
polypeptideAT3G60570.1TAIR10ch03:22391247..22392463252+n/a
Add items to a list:

Features this mRNA is a part of 
TypeNameLocationLengthStrandPhase
geneAT3G60570TAIR10ch03:22391247..223924631,217+n/a
Add items to a list:

Features that are parts of this mRNA 
TypeNameLocationLengthStrandPhase
exonexon-auto18249459TAIR10ch03:22391247..22391400154+n/a
exonexon-auto18249460TAIR10ch03:22391501..22391613113+n/a
exonexon-auto18249461TAIR10ch03:22391701..22391871171+n/a
exonexon-auto18249462TAIR10ch03:22392143..22392463321+n/a
Add items to a list:

Related views  
http%3A%2F%2Fwww.sgn.cornell.edu%3A8080%2Ffeature%2F18249457%2Fdetails feature 18249457
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)