Arabidopsis thaliana mRNA AT4G02570.4

mRNA details  
Name Type Organism
Synonyms / aliases
CUL1
Length
2,793
  
Description
cullin 1
Location(s)
TAIR10ch04:1128515..1133774
GFF source
TAIR10
mRNA sequence spliced mRNA sequence, including UTRs 
>AT4G02570.4 cullin 1

AAAAGGTAAGAAATTAAATTTGTTTAATATTATACTAATATATTAGTTGACATAAAATAAAAATAATTAAATCTATAAGACCTGAAAATAATAGAATAGAAGAGAACGAGTTTGTTTCCTGAGATATCTTTTCACCGCCCTTCTCATAGCAGCTCTCGCCGATCCTGTGTAATCGGGAATCGGTAATCGTCAGGGTCTGTTTGGGGTTGAGGAGAGCTTGAAAAGTTGTTTGTCAACATGGAGCGCAAGACTATTGACTTGGAGCAAGGATGGGACTATATGCAGACTGGAATTACTAAGCTGAAACGGATTCTGGAAGGATTGAATGAGCCAGCATTTGACTCTGAGCAATATATGATGCTTTATACGACTATCTACAACATGTGCACCCAGAAACCTCCTCATGATTACTCACAGCAGCTTTATGACAAGTATCGGGAAGCATTTGAGGAATATATTAACTCAACAGTTTTGCCTGCGTTGAGGGAGAAGCATGATGAGTTTATGCTGCGGGAGCTATTTAAAAGATGGTCAAACCATAAAGTAATGGTCAGATGGCTATCCCGCTTCTTCTACTACCTTGACCGTTACTTCATTGCTCGGAGATCACTTCCACCACTGAATGAAGTTGGCCTGACATGCTTCCGTGACCTGGTTTATAATGAGCTACATTCTAAGGTCAAACAAGCTGTAATAGCTCTTGTTGATAAAGAACGGGAGGGCGAGCAGATTGATAGGGCCCTGCTGAAAAACGTATTAGATATCTATGTAGAGATTGGAATGGGGCAGATGGAGAGGTATGAAGAAGATTTTGAAAGCTTCATGCTTCAAGATACTTCTTCGTATTATTCTCGCAAGGCATCAAGCTGGATTCAGGAAGATTCTTGCCCTGATTACATGTTGAAGTCTGAAGAATGTCTAAAGAAGGAGAGGGAGAGAGTGGCTCACTACCTACACTCAAGCAGTGAGCCAAAGCTGGTTGAGAAAGTACAACATGAATTGCTGGTTGTGTTTGCAAGTCAGCTTCTAGAAAAAGAACACTCAGGGTGCCGTGCATTGCTAAGAGATGACAAGGTGGATGATCTCTCCAGGATGTACAGGCTTTACCATAAAATTTTGCGAGGCTTGGAACCTGTTGCAAACATCTTTAAGCAGCATGTCACAGCAGAGGGTAACGCTCTTGTCCAACAGGCCGAAGACACGGCTACTAATCAGGTTGCAAATACTGCTAGCGTCCAGGAACAGGTTCTTATCAGAAAAGTGATTGAACTTCATGATAAATACATGGTATATGTCACCGAGTGTTTCCAGAACCACACCCTCTTCCATAAGGCTTTGAAAGAGGCATTTGAGATTTTTTGTAACAAAACGGTTGCTGGAAGTTCAAGTGCAGAACTACTTGCAACATTTTGCGACAATATTCTCAAAAAGGGGGGAAGTGAAAAGCTGAGTGATGAAGCTATCGAAGATACGCTTGAGAAGGTTGTCAAATTGCTTGCATACATAAGTGACAAGGATCTTTTCGCTGAGTTCTACAGGAAGAAGCTGGCCCGTAGGCTCTTATTTGATCGCAGTGCTAATGATGATCATGAGAGAAGTATCCTGACAAAGCTCAAGCAACAATGTGGTGGACAGTTTACTTCTAAGATGGAGGGCATGGTGACGGATTTGACACTGGCAAGAGAAAACCAAAACAGTTTCGAGGATTATCTAGGCAGTAACCCTGCTGCAAACCCAGGGATTGACTTGACCGTCACTGTTCTTACCACTGGTTTCTGGCCAAGTTACAAATCATTTGACATAAATCTACCCAGTGAAATGATCAAGTGTGTTGAAGTCTTCAAAGGGTTTTATGAAACGAAAACGAAACACAGGAAGCTTACGTGGATCTATTCACTGGGAACTTGTCACATAAACGGGAAGTTTGATCAAAAGGCCATCGAGTTAATAGTGTCTACTTACCAGGCTGCTGTGCTTCTACTCTTTAACACAACTGACAAGTTAAGTTACACTGAGATCTTGGCTCAACTGAACCTAAGCCATGAAGATCTAGTTAGGTTGCTTCATTCCTTGTCATGTGCTAAGTACAAGATACTCCTTAAGGAGCCAAACACCAAGACTGTCTCCCAGAATGATGCCTTTGAGTTCAACTCCAAATTCACCGATAGAATGCGCAGAATCAAGATCCCTCTTCCCCCAGTTGATGAAAGGAAGAAAGTCGTTGAAGATGTCGATAAAGACAGAAGATATGCAATTGATGCTGCCATTGTCAGGATCATGAAGAGCAGGAAAGTATTGGGACATCAACAACTTGTTTCTGAGTGTGTTGAGCAACTTAGCCGAATGTTCAAGCCTGATATCAAAGCGATCAAGAAGCGTATGGAGGATTTAATAACCAGAGATTATTTGGAGAGGGACAAGGAGAATCCTAACATGTTTAGGTACTTGGCTTAGGGCAAAAAAACAACAACTATGGAAGTGGTTGGCTCATGAAAGGAATCTGCTTGTATATTTAGAAGTCCATATGGAGACTGTCCTAAAACAAATTTATCGCTTCATTTTCGCTATTTTTCTCTTTTAAAAAATATTCGGTCTGTGCTTTTTTTTTGGGATGCAAATTTGCCTTGTGGATTTTTGTTTCTTAAATATTGAATGGAGATGGAGAAATGGCCTTAATGAATGAATCTCTGCTTTCTAATATATTTATCCTTGATCATATTATTTAAGTTTTATGTATCTCTGTGTTATATTGACGGATGGGAAAGTCGTAACAAATAATATGAGATTTCTTAT
Genomic sequence(s) unprocessed genomic sequence underlying each location of this mRNA 
Related features  
Features that derive from this mRNA 
TypeNameLocationLengthStrandPhase
polypeptideAT4G02570.4TAIR10ch04:1129315..1133435738+n/a
Add items to a list:

Features this mRNA is a part of 
TypeNameLocationLengthStrandPhase
geneAT4G02570TAIR10ch04:1128515..11337745,260+n/a
Add items to a list:

Features that are parts of this mRNA 
TypeNameLocationLengthStrandPhase
exonexon-auto18256649TAIR10ch04:1128515..1128663149+n/a
exonexon-auto18256650TAIR10ch04:1128758..112881356+n/a
exonexon-auto18256651TAIR10ch04:1129283..1129445163+n/a
exonexon-auto18256652TAIR10ch04:1129532..1129631100+n/a
exonexon-auto18256653TAIR10ch04:1129806..1129991186+n/a
exonexon-auto18256654TAIR10ch04:1130074..113012148+n/a
exonexon-auto18256655TAIR10ch04:1130211..1130414204+n/a
exonexon-auto18256656TAIR10ch04:1130503..113058078+n/a
exonexon-auto18256657TAIR10ch04:1130781..113087090+n/a
exonexon-auto18256658TAIR10ch04:1130953..113103381+n/a
exonexon-auto18256659TAIR10ch04:1131156..113121560+n/a
exonexon-auto18256660TAIR10ch04:1131296..113132530+n/a
exonexon-auto18256661TAIR10ch04:1131430..113151687+n/a
exonexon-auto18256662TAIR10ch04:1131608..1131757150+n/a
exonexon-auto18256663TAIR10ch04:1131831..113188656+n/a
exonexon-auto18256664TAIR10ch04:1132073..1132193121+n/a
exonexon-auto18256665TAIR10ch04:1132286..1132447162+n/a
exonexon-auto18256666TAIR10ch04:1132533..1132676144+n/a
exonexon-auto18256667TAIR10ch04:1132759..1132977219+n/a
exonexon-auto18256668TAIR10ch04:1133077..1133244168+n/a
exonexon-auto18256669TAIR10ch04:1133334..1133774441+n/a
Add items to a list:

Related views  
http%3A%2F%2Fwww.sgn.cornell.edu%3A8080%2Ffeature%2F18256647%2Fdetails feature 18256647
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)