Arabidopsis thaliana mRNA AT4G35860.1

mRNA details  
Name Type Organism
Synonyms / aliases
ATRABB1B, ATGB2, ATRAB2C, GB2
Length
1,122
  
Description
GTP-binding 2
Location(s)
TAIR10ch04:16986840..16989047
GFF source
TAIR10
mRNA sequence spliced mRNA sequence, including UTRs 
>AT4G35860.1 GTP-binding 2

ATTAGATCCCTTTAATTTTAGTAATTAAGTAAAAAGATTATAAAAGATGAGAAGGAGAAGATAGCTTCTTCATCGAGAAACCTCGAAATCAAAAAGCACGTCGGTGACTTGTACTCTTCAATCTCTTCTTCCTCTCTTTCACATCTCCTTCTCTCGAACCCATCGACCTGCGCTAATTCATCATCGACCTTGCTCAAATTCATCAACCATGTCTTACGATTATCTCTTCAAGTACATAATCATCGGAGACACAGGTGTGGGAAAATCGTGTCTGCTTCTGCAATTTACTGATAAGAGGTTCCAACCAGTCCACGATCTCACCATTGGTGTTGAGTTCGGTGCTCGGATGGTCACCGTCGATGGACGCCCCATCAAACTCCAAATTTGGGACACCGCTGGACAAGAATCTTTTAGATCCATCACCAGATCATACTACAGAGGAGCAGCCGGAGCTTTACTGGTTTATGACATCACCAGGAGAGAGACGTTTAACCATCTGGCAAGCTGGTTGGAGGATGCTCGGCAACATGCAAATCCTAACATGAGTATTATGCTGATTGGGAACAAATGTGATCTTGCTCACAAGAGAGCTGTTAGCAAAGAGGAAGGTCAACAGTTTGCCAAAGAACATGGCCTGCTATTCTTAGAAGCATCTGCAAGAACTGCTCAAAACGTTGAGGAGGCCTTCATAGAGACTGCTGCCAAGATCCTCCAGAACATTCAGGATGGTGTCTTTGATGTATCCAACGAGTCATCAGGTATCAAGATTGGTTACGGGCGTACTCAAGGTGCAGCTGGAGGAAGAGATGGTACGATCTCTCAGGGAGGTGGCTGTTGTGGTTAAAAAATCCTCGAGAGAGGTGTCACATATCTGCTGTAATCTGGTGATTCAGAAACTACTATTGCTTCTATTTACCTCTGCAAATGGATACACCAGAATGTATAGTTTCTCTTTCTTTCTTTCTTTTTTTCTCTTTTTCCCAGATTGTCTTTTATCAAAAAACCAAACGGGTGCATTTAAGAGTGAACAGGCTGATCTTTATAAACCAAACAGGCGTTGGCTTATTTAAAACGTTGTCGCTTTGTATGAAGCTCTCAAGGTTAAGTAATTGAAATCAAATC
Genomic sequence(s) unprocessed genomic sequence underlying each location of this mRNA 
Related features  
Features that derive from this mRNA 
TypeNameLocationLengthStrandPhase
polypeptideAT4G35860.1TAIR10ch04:16987118..16988839211-n/a
Add items to a list:

Features this mRNA is a part of 
TypeNameLocationLengthStrandPhase
geneAT4G35860TAIR10ch04:16986840..169890472,208-n/a
Add items to a list:

Features that are parts of this mRNA 
TypeNameLocationLengthStrandPhase
exonexon-auto18298074TAIR10ch04:16988794..16989047254-n/a
exonexon-auto18298075TAIR10ch04:16988540..16988679140-n/a
exonexon-auto18298076TAIR10ch04:16988048..1698813083-n/a
exonexon-auto18298077TAIR10ch04:16987481..16987685205-n/a
exonexon-auto18298078TAIR10ch04:16987319..1698738769-n/a
exonexon-auto18298079TAIR10ch04:16986840..16987210371-n/a
Add items to a list:

Related views  
http%3A%2F%2Fwww.sgn.cornell.edu%3A8080%2Ffeature%2F18298072%2Fdetails feature 18298072
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)