Oryza sativa mRNA Os06t0131300-00

mRNA details  
Name Synonyms / aliases
ADC, ARGDC, OsADC1
Type Organism
Description
Similar to Arginine decarboxylase (EC 4.1.1.19) (Fragment).
Location(s)
IRGSP_chr06build05r1:1673666..1675774
Ontology term(s)
KEGG GFF source
IRGSP_build5_rep
InterPro
Orf evidence
O81161 (UniProt)
Transcript evidence
Q9SNN0 (UniProt)
mRNA sequence spliced mRNA sequence, including UTRs 
>Os06t0131300-00 Similar to Arginine decarboxylase (EC 4.1.1.19) (Fragment).

ATGCCTGCGCTCGCCGTGGACGCCGCTGCACCTGTCGCGCACGCCTTCGCGTGCGACGCGGCGCGCTTCCCCGCGCCGCTGCTGGGCCCCGCCGCCGCGGCTGCGGCGGTGGCGGAGAAGCCGGACGCGGCCGCGTGGTCGGCCGACCTCTCGTCCGCGCTGTACAACGTGGACGGCTGGGGCGCGCCGTACTTCTTCGTCAACGACGACGGCGACGTCGCCGTGCGCCCGCACGGCGCCGCAACCCTGCCCGGGCAGGAGATCGACCTCGCCAAGGTGGTGGCCAAGGCCGCCGGCCCGCGCTCCGGCGGCGGGCTCGGCCTGCCGCTCCCCCTGCTGGTGCGGTTCCCCGACGTGCTCCGCCACCGCGTGGAGGCCCTGAACGCGGCGTTCGACTACGCCGTGCGCTCCACCGGCTATGGCGGGAGGTACCAGGGCGTGTACCCCGTCAAGTGCAACCAGGACCGCCACGTCGTGGAGGACATTGTGGAGTTCGGCGAGCCGTTCCGCTTCGGCCTGGAGGCCGGCTCCAAGCCCGAGCTGCTGCTCGCCATGAGCTGCCTCGCCGCGCGCGGCAACCCGGACGCCCTGCTCATCTGCAACGGCTACAAGGACGACGAGTACGTCTCGCTCGCGCTCATCGCGCGCACCATGGGGCTCAACACGGTCATCGTGCTCGAGCAGGAGGAGGAGCTCGACATTGTGGTCGACGCTAGCCGCCGCCTCGGCGTGCGCCCGGTGGTCGGCATGCGCGCCAAGCTGCGCACCAAGCACGCCGGCCACTTCGGCTCCACGTCCGGGGAGAAGGGCAAGTTCGGCCTCAACGCCGCGCAGATTCTCTCCGTCGTCGCCAAGCTCAAGACCCTTGGTATGCTCGACTGCCTCCAGCTCCTGCACTTCCACATTGGCTCCCAGATCCCGACCACTGCTCTGCTCGGCGATGGCGTCGGGGAGGCCGCGCAGATCTACTGCGAGCTCGCCCGCCTGGGCGCGGCCATGCGCGTCATCGACGTTGGTGGAGGCCTCGGCATTGACTACGACGGGAGTCACTCGGCGCAGACCGACATGTCCGTGGCATACAGCTTGGAGGAGTACGCGGCGGCCGTGGTGGCCGCCGTCGGCCGCGTCTGTGACCGCAAGGGCGTCGCGCATCCCATCATCTGCAGCGAGAGCGGCCGCGCGCTGGTGTCGCACCACTCTGTCCTGGTGTTCGAGGCCTTCTCGGCTTCGGCGCCCGGCCGCATTGACCCGGCCACGGGCTACCTGCTCGACGAGCTCACCGACGACTGCCACGCCGACTACCGCAACCTCATGGCCGCCGCGGTGCGCGGCGACTTCGACACCTGCGCTCTGTACGCCGACCAGCTGAAGCGGCGCTGCGCCGATCAGTTCAAGGACGGCGTTCTTGGCCTGGAGCACCTCGCCGCGGTGGACAGCCTCTGCGAGATCGTCGCCCGCGGCATGGGCGCCGCCGAGCCGCCGCGCACGTACCACATCAACCTGTCCGTGTTCACCTCCCTGCCGGACATGTGGGCGATCGGGCAGATGTTCCCGATCATCCCAATCCAGCGCCTCGGTGAGCGCCCTGCGGTCGACGGCGTCCTCTCCGACCTCACCTGCGACAGCGACGGCAAGGTCGACCACTTCATCGGCGGGAGGCACAGCCTGCCGCTGCACGAGCTCCCCGTCCACGGCACCCGCGGCTACTACCTCGGCATGTTCCTCGGCGGCGCCTACCAGGAGGCCCTCGGCGGCCTCCACAACCTGTTCGGCGGGCCGAGCGTGGTGCGCGTGTCGCAGAGCGACGGGCCGCACTGCTTCGCCGTCACGCGCGCGGCGGCGGGGCCGTCGTGCGCCGACGTGCTCCGCTCGATGCAGCACGAGCCCGAGGTGATGTTCGAGGTGCTCAAGCAGAGGACCGACGGCGCCACCGCCGCCGCGCTCGCCAGGGCGTTCGGCGCAATGCCGTACCTGTCGTTCGACCCGGAGGCCGCGGCGATGGCCAGCGGGGAGAGCAGCGGCATGAGCAGCGACTCGGAGGGGTCGGCCGCCGGCGCGGCGGAGGAGGATGACGACGAGTGGGAGTTCATGCGGGGGCTCACCGTGTGA
Genomic sequence(s) unprocessed genomic sequence underlying each location of this mRNA 
Related features  
Features that derive from this mRNA 
TypeNameLocationLengthStrandPhase
polypeptideOs06t0131300-00IRGSP_chr06build05r1:1673666..1675774n/a-n/a
Add items to a list:

Features this mRNA is a part of 
TypeNameLocationLengthStrandPhase
geneOs06g0131300IRGSP_chr06build05r1:1673666..16757742,109-n/a
Add items to a list:

Features that are parts of this mRNA 
TypeNameLocationLengthStrandPhase
exonexon-auto18817900IRGSP_chr06build05r1:1673666..16757742,109-n/a
Add items to a list:

Related views  
http%3A%2F%2Fwww.sgn.cornell.edu%3A8080%2Ffeature%2F18765812%2Fdetails feature 18765812
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)