Oryza sativa mRNA Os12t0274700-01

mRNA details  
Name Synonyms / aliases
AK121444, AK061611, AK119219, RBCS-C, rbcS
Type Organism
Description
Similar to Petunia ribulose 1,5-bisphosphate carboxylase small subunit mRNA (clone pSSU 51), partial cds. (Fragment).
Location(s)
IRGSP_chr12build05r1:10088020..10089103
Ontology term(s)
InterPro GFF source
IRGSP_build5_rep
KEGG
Expression
AK121444
Nias flcdna
J023141B14
Orf evidence
Q40892 (UniProt)
Transcript evidence
AK121444 (DDBJ, Best hit)
mRNA sequence spliced mRNA sequence, including UTRs 
>Os12t0274700-01 Similar to Petunia ribulose 1,5-bisphosphate carboxylase small subunit mRNA (clone pSSU 51), partial cds. (Fragment).

GCGTGAGCCAGCCACAAACGCCCGCGGATAGGCGCGCGCACGCCGGCCAATCCTACCACATCCCCGGCCTCCGCGGCTCGCGAGCGCCGCTGCCATCCGATCCGCTGAGTTTTGGCTATTTATACGTACCGCGGGAGCCTGTGTGCAGAGCAGTGCATCTCAAGAAGTACTCGAGCAAAGAAGGAGAGAGCTTGGTGAGCTGCAGAGATGGCCCCCTCCGTGATGGCGTCGTCGGCCACCACCGTCGCTCCCTTCCAGGGGCTCAAGTCCACCGCCGGCATGCCCGTCGCCCGCCGCTCCGGCAACTCCAGCTTCGGCAACGTCAGCAATGGCGGCAGGATCAGGTGCATGCAGGTGTGGCCGATTGAGGGCATCAAGAAGTTCGAGACCCTCTCCTACCTGCCACCGCTCACCGTGGAGGACCTCCTGAAGCAGATCGAGTACCTGCTCCGTTCCAAGTGGGTGCCCTGCCTCGAGTTCAGCAAGGTCGGATTCGTCTACCGTGAGAACCACAGATCCCCCGGATACTACGATGGCAGGTACTGGACCATGTGGAAGCTGCCCATGTTCGGGTGCACTGACGCCACCCAGGTGCTCAAGGAGCTCGAGGAGGCCAAGAAGGCGTACCCTGATGCATTCGTCCGTATCATCGGCTTCGACAACGTCAGGCAGGTGCAGCTCATCAGCTTCATCGCCTACAAGCCCCCGGGCTGCGAGGAGTCTGGTGGCAACTAAGCCGTCATCGTCATATATAGCCTTGTTTAATTGTTCATCTCTGATTCGATGATGTCTCCCACCTTGTTTCGTGTGTTCCCAGTTTGTTCATCGTCTTTTGATTTTACCGGCCGTGCTCTGCTTTTGTTTTTGTTTCACCTGATCTCTCTCTGACTTGATGTAAGAGTGGTATCTGCTACGACTATATGTTGTTGGGTGAGGCATATGTGAATGAAATATATGGAAGCTCCGGCTATATATATTTAT
Genomic sequence(s) unprocessed genomic sequence underlying each location of this mRNA 
Related features  
Features that derive from this mRNA 
TypeNameLocationLengthStrandPhase
polypeptideOs12t0274700-01IRGSP_chr12build05r1:10088266..10088896n/a-n/a
Add items to a list:

Features this mRNA is a part of 
TypeNameLocationLengthStrandPhase
geneOs12g0274700IRGSP_chr12build05r1:10088020..100891031,084-n/a
Add items to a list:

Features that are parts of this mRNA 
TypeNameLocationLengthStrandPhase
exonexon-auto18872974IRGSP_chr12build05r1:10088020..10088646627-n/a
exonexon-auto18872975IRGSP_chr12build05r1:10088750..10089103354-n/a
Add items to a list:

Related views  
http%3A%2F%2Fwww.sgn.cornell.edu%3A8080%2Ffeature%2F18799046%2Fdetails feature 18799046
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)