Clone Read LE_HBa0141O14_T7_100155

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0141O14_T7_100155
Primer
T7
ID from Seq. Facility
LE_HBa_141_O14-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
618 trimmed for vector and quality, 873 raw
Sequence
>LE_HBa0141O14_T7_100155 (raw untrimmed)
CTAAACCTGGGACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGTTTAAGGCCATAAAGAGATCCCTTCAATCTGCAAACTTGATCACTG
CCAACTTTTCTATTAACACCTTCAGGTGGTTTCATATATACTTCTTCATATAAATCTCCTTGTAAAAATGCATTGTATACATCCATCTGATGTATTATCC
AGTGATTAGTAGCTGCAATAGATACAACAGACCTCACAGTTGCCATCTTCACCACTGGAGAGAAAGTTTCTTGGTAATCAAATCCTTCCTTTTGATTGTA
CCCCTTAGCAACTAGTCTAGCCTTGTATCTCTCTACACTTCCATCTGCATTATATTTGATCTTGTATACCCATTTACAACCTATAGCCCTTTTATCCTTA
GGCAATGTCACCATTTCCCATGTGCCATTATCTTCTAGTGCTTTGATCTCATTCTTCATAGCATCTATCCATCTAGGATCTTGTACTGCCTCTAAGTAAC
TTGATGGTTCAGTTTCAACAGAAAACTTTGACACAAAACTTTGATATGTAGGTGATAATCCTTCAAAGTCTAATACTGATGCAAGAGAGTAATTACATTT
CTAAGAACCAACTGTGACTACATAGTCCTTTGTGCCAAATAGGAAGCCTATAGTTTCTGCTTGATTTCTTAAAAGGTGGAGCATTAATGTCACAATAAAT
CTTCTGCCAAACTTTTTTACCAATCTCCATAATTTTAAAAGAAAAAAAACTATGACTTTGCAAAACTATTAAATATAAAAACTGATCATATTAAAATCCA
ACCAAATTCACTCCCTCTTAACTCACCACATATATTAGATATTATACATTATTATCATACTCCCATCATCACT
>LE_HBa0141O14_T7_100155 (trimmed for quality and cloning vector)
AGCTTGTTTAAGGCCATAAAGAGATCCCTTCAATCTGCAAACTTGATCACTGCCAACTTTTCTATTAACACCTTCAGGTGGTTTCATATATACTTCTTCA
TATAAATCTCCTTGTAAAAATGCATTGTATACATCCATCTGATGTATTATCCAGTGATTAGTAGCTGCAATAGATACAACAGACCTCACAGTTGCCATCT
TCACCACTGGAGAGAAAGTTTCTTGGTAATCAAATCCTTCCTTTTGATTGTACCCCTTAGCAACTAGTCTAGCCTTGTATCTCTCTACACTTCCATCTGC
ATTATATTTGATCTTGTATACCCATTTACAACCTATAGCCCTTTTATCCTTAGGCAATGTCACCATTTCCCATGTGCCATTATCTTCTAGTGCTTTGATC
TCATTCTTCATAGCATCTATCCATCTAGGATCTTGTACTGCCTCTAAGTAACTTGATGGTTCAGTTTCAACAGAAAACTTTGACACAAAACTTTGATATG
TAGGTGATAATCCTTCAAAGTCTAATACTGATGCAAGAGAGTAATTACATTTCTAAGAACCAACTGTGACTACATAGTCCTTTGTGCCAAATAGGAAGCC
TATAGTTTCTGCTTGATT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.944395
Expected error %
1.11241
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g23160.1 Score 196 E Value 8e-51 Identity 17.70% Align. Length 542bp (87.70%) Frame 2
68417.m03342 protein kinase family protein contains Pfam domain PF00069: Protein kinase domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU89728.1| Score 249 E Value 5e-65 Identity 21.10% Align. Length 581bp (94.01%) Frame 2
putative retroelement pol polyprotein-like [Solanum tuberosum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAD25830.1| Score 206 E Value 5e-52 Identity 16.60% Align. Length 578bp (93.53%) Frame 2
putative retroelement pol polyprotein [Arabidopsis thaliana] pir||B84458 probable retroelement pol polyprotein [imported] - Arabidopsis thaliana
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0141O14
Clone
Clone name
hba-141o14
LE_HBa0141O14
P141O14
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found