Clone Read LE_HBa0144M21_T7_100841

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0144M21_T7_100841
Primer
T7
ID from Seq. Facility
LE_HBa_144_M21-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
1 trimmed for vector and quality, 1070 raw
Sequence
>LE_HBa0144M21_T7_100841 (raw untrimmed)
TAATTGCGAAGAATCTCTTTTATCGTCAAATCTGTGTCATGTGTACATGGCGCTCTCTCGTGTATAAGTTCGATCATAATATCANATCTCTGCAATGCAA
ANGACAGATATTTCTAATNTCATTATATCTACAGGTCTGGACGAGTACTAAGTCAGATAACATCATAAATATTCTTCTCCCTTCTACATGCACATGTCTC
GACTGGTTGCACGCCGCAACAATCAGACCCGTCTCTGTCACACGTCCAGCAGCCACTTCACTAGAGCCTCTATCCTGCCTCTCAGACNAATGCACGAGAC
AGCTGCCGCTCTCAGTACTGAGAGAGCATGTAAGTACTCACATGACAGTACATCGANACCACCGNATCACGCCGGCTGTATAATGGGATTGGTGTAANGT
AGTGCACTGATATTGCACATGGCAATGATTACGTATAACCTNCTCATATATCTCTCGATGTGCTATAGTGAATGCTATGCATGGATATCGCCTCATCAGC
GCCTCTAGATCGACTTGATGCGCCTGTTCATCGCCNCTGCGCGCATTCCCGAGACGCTCCGCGGTCTCTAGGTCTGCACATCTCTACTGAGGTGATTCCT
TGTAATGGATCTCCATCTACTACTGCAGATCAATCTCTTTCTACTGTCTCGCATATTCTATGCATGGTGTGGTCACAGTGTCGCTCGCNAGTACGTTGAA
TGTTATGTACTTTGGTCCTTCATATGTCTTTGTGTGATGTCTGNTGCATTACTTACANCTTCAGATCGTTATTCGTACTCTGTCTTATTGGACATATTCT
CTGTACGTATAATGTCTGCCACATATCTTCAATTTTATCTAAATATCTATGATATATATACCAAACTACTGAACCGTTGTCAAGCTCATATTTCNATACT
ATGCGCAAGAACCACCTCATCCTCACTATACTCGCCAGACGTCACTCGTTCATCGGTCTGCGCATTAGAGTGCTCACGATACGACTGCTCTTCACATCTT
GCTATGATCCATCAAGTATCTCTTTTATACTCATCGACAGCCAGACAGAATAACAGAACCAACAAGAACG
>LE_HBa0144M21_T7_100841 (trimmed for quality and cloning vector)
T

This is probably not a useful sequence.

Problems:
  • High predicted error rate
  • Low complexity
  • Short cloning insert
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
not recorded
Expected error %
100
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0144M21
Clone
Clone name
hba-144m21
LE_HBa0144M21
P144M21
Clone type
BAC
Contamination
none
Estimated length
103,990
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found