Clone Read LE_HBa0148A21_SP6_101032

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0148A21_SP6_101032
Primer
SP6
ID from Seq. Facility
LE_HBa_148_A21-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
604 trimmed for vector and quality, 917 raw
Genbank Accession
Sequence
>LE_HBa0148A21_SP6_101032 (raw untrimmed)
GGCCGAGGGTGGAGGTCGTTGGCGATTTCTTGATTTCTCGCCTCTTTTCTCTTCTTTTCTCTCATCTTCAAGCCCTAGCATAAGTTCTCTTATTTTTTAA
CTTAGTAAAGTCATATTTCATTCTGATAAATCCCAAAAAAGGAAATAGGAATTTAATTAAGGAGAAGACTAGTTATACCTTCAGTAATCCAGATTTGTAC
TTTCTTTAATCAAACATCCCAACTTCTCGAAGGCATAACTCGCTCATAAGATATCGAAATCATGCAAACATGACGTCATTGGAAAAAATATTCTATGGAC
TTTCCAACCTTATCTGGAACATCCATAACTCATCCTTATATATTAGTTTTGGTTGTTTGAAGTTAACCAAAACTCACTGTATAACTTAAATAAATTTTCT
GTATTTCTTTATTCTTTCAAAAAATAACTATTTTCAAAATTTAAACATATTTCTAGTTCTTTCTAATCTAGAGATGTTACAATATCTTCCCCTTGGGGAT
ATTTGTCCTTAAATAAGGTTACTCTTATTAGGCTTAGGGTAGGAACATCAAGTTCAAACACACACAAGCAAATGCAACCAAACAGCATGCTTACTGAAAT
TTAAATAGGACTAATAAGAAAATTAGTACCTTGGTCTGTATTTAATCCAGATTTGAAGAGGTGCAGATTTCTCTTCGTCATTCCCCTCCCTCAGCTTCGT
CTAGTAAATTCTACATCTATATCTTTCCTCCGATGGACCTTGGCTGATTCTCGATCTTTGTTATCCTCCTTGGAAATTTGTCGATCGTCATTTGTACCGA
AAAACTTATTAAGATAGTGAATCTTTGTTTTTAATGTTTACTTAGGAATGGTCAAGGTGGTGCTGTCCTCGGTTTTGTCCAATAGTGGTGATCTAGACTC
GAATGCTTTCGCCTGAC
>LE_HBa0148A21_SP6_101032 (trimmed for quality and cloning vector)
TCTTTTCTCTTCTTTTCTCTCATCTTCAAGCCCTAGCATAAGTTCTCTTATTTTTTAACTTAGTAAAGTCATATTTCATTCTGATAAATCCCAAAAAAGG
AAATAGGAATTTAATTAAGGAGAAGACTAGTTATACCTTCAGTAATCCAGATTTGTACTTTCTTTAATCAAACATCCCAACTTCTCGAAGGCATAACTCG
CTCATAAGATATCGAAATCATGCAAACATGACGTCATTGGAAAAAATATTCTATGGACTTTCCAACCTTATCTGGAACATCCATAACTCATCCTTATATA
TTAGTTTTGGTTGTTTGAAGTTAACCAAAACTCACTGTATAACTTAAATAAATTTTCTGTATTTCTTTATTCTTTCAAAAAATAACTATTTTCAAAATTT
AAACATATTTCTAGTTCTTTCTAATCTAGAGATGTTACAATATCTTCCCCTTGGGGATATTTGTCCTTAAATAAGGTTACTCTTATTAGGCTTAGGGTAG
GAACATCAAGTTCAAACACACACAAGCAAATGCAACCAAACAGCATGCTTACTGAAATTTAAATAGGACTAATAAGAAAATTAGTACCTTGGTCTGTATT
TAAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.911611
Expected error %
0.252713
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0148A21
Clone
Clone name
hba-148a21
LE_HBa0148A21
P148A21
Clone type
BAC
Contamination
none
Estimated length
79,469
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found