Clone Read LE_HBa0148A21_T7_101033

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0148A21_T7_101033
Primer
T7
ID from Seq. Facility
LE_HBa_148_A21-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
292 trimmed for vector and quality, 731 raw
Genbank Accession
Sequence
>LE_HBa0148A21_T7_101033 (raw untrimmed)
CTGGACCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGCATCTATGTGAAAAACTCCAATGAAAGATTGTAATTCTTTTTCTTTACGTAG
ATGATATTTTATTAGTTGGAAATACTTTGGAGTATGTGAAACTATCAAGTCATGGCTTTCAACATTATTTCACATGAAATATATGGGTGAAGCAGATTAT
ATATTGACTGTTAAGATCCAAGGAGACCGTACCAAGAAATTTGATTTTATCTCAAGAAACTTACGTAAAGAAAATATTGGAATACTTTTTAAAGAATTAA
CCTTTCTATGGAAGTCTTAGTTGGACTCAACTTTGCTACACATCCTTCTTCAATCTAGATCATGAAAAGGCCTTTTATTCTTTTCTGTTTAGAGCTTATT
TCTTGATTTTTTTGTGTTTTTTAAAATTTATCCTTAATTTATCTTTTCCTTGTCTCTCTTTGTTCTTCATTTCTCTAAGTGGTTTTATTTAATTATACTA
TTCTTCAAAGATCTATGTTATATATCTCTACATTATATATTATTTGTCTAACTTTCTCTATAACTTATTACATCAGAATTTGTTCTTTACTCTACACCTC
TTTTCTACACCTTATTAGAGTTTTACATAATCGCTATTTTTTTTTTTCTGTTCCTATTTTTATCCTTTTTATTTTCATTTTTATTCTTTCTTTCTTTTTT
CTTTTTTTTTTTTTTTTTTTCTTTTTTAATA
>LE_HBa0148A21_T7_101033 (trimmed for quality and cloning vector)
AGCTTGCATCTATGTGAAAAACTCCAATGAAAGATTGTAATTCTTTTTCTTTACGTAGATGATATTTTATTAGTTGGAAATACTTTGGAGTATGTGAAAC
TATCAAGTCATGGCTTTCAACATTATTTCACATGAAATATATGGGTGAAGCAGATTATATATTGACTGTTAAGATCCAAGGAGACCGTACCAAGAAATTT
GATTTTATCTCAAGAAACTTACGTAAAGAAAATATTGGAATACTTTTTAAAGAATTAACCTTTCTATGGAAGTCTTAGTTGGACTCAACTTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.909156
Expected error %
1.4122
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0148A21
Clone
Clone name
hba-148a21
LE_HBa0148A21
P148A21
Clone type
BAC
Contamination
none
Estimated length
79,469
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found