Clone Read LE_HBa0148B07_SP6_101052

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0148B07_SP6_101052
Primer
SP6
ID from Seq. Facility
LE_HBa_148_B07-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
410 trimmed for vector and quality, 845 raw
Genbank Accession
Sequence
>LE_HBa0148B07_SP6_101052 (raw untrimmed)
GCAAGCAATGAGACGAAACCAGCCACTTGGTTTGTTACCTTCAGAGAACCAAGAGTAAGCTTCTTAAAAAGATGACCTTTACCAATGGCAGGGACTGTTC
AAGAGGAGATTAGGACCTTAAGGGATGAAACAAAAAAATATACACATATTCTCCTCTTTACTCTGTTAACAGATAAAAAAGTAATATCTTCCAATATATT
TTCTTGGATATAACTAGTAGGTCAAATTCATGTTTTCTTTGTATTTGTTTGATTGATAGGTCAACATGTAAACTCATAACCAAGTAAAATATTTATACAA
AATAAGGAGATTTAGAAAACAATGATGCTTAGACCATTTGTAGGCTAGGCTAAGCAGGCATAGACAACTTTTAGATGCTTCGGTTTTGATCAAGAAGGAA
CTGTGACCACAAAAATAGTCATTTTGTTGCTCGTTTGTGTGTAACAAGGCTACAGAACTGCATACTGGTGGGCTAATCCTCTTACAAAATAAAGCATTGT
GGGAAACAACCGAAAATGATGACCTTTGAATTCCAAAAATGGTCAAATTAGTGAACCGAATCCAAACCGGTCCAATCCTTTAATTCTCCCGGTGAAATTA
TCTTAATTAATAAAAAAGGGGACCCCCAATGGGGGGGAGTGAACTTCCCCCCGATTCCTTTACTAATGGGCAACGTAAATACCTGGGGAATGAGCCCCAA
AAAAACCCACCCCTTTTTTAGATAAAACACCTTGCCAACCCCAAGGTTTTTAAAAAAAAGGAATGTGAACCCTTTTCCCCTTTTTGAAAAATTTGTTGTG
GAAATGGGCCTTTGGGGGGGAACTCCCTAATTTAAAAACAAAATT
>LE_HBa0148B07_SP6_101052 (trimmed for quality and cloning vector)
TTGTTACCTTCAGAGAACCAAGAGTAAGCTTCTTAAAAAGATGACCTTTACCAATGGCAGGGACTGTTCAAGAGGAGATTAGGACCTTAAGGGATGAAAC
AAAAAAATATACACATATTCTCCTCTTTACTCTGTTAACAGATAAAAAAGTAATATCTTCCAATATATTTTCTTGGATATAACTAGTAGGTCAAATTCAT
GTTTTCTTTGTATTTGTTTGATTGATAGGTCAACATGTAAACTCATAACCAAGTAAAATATTTATACAAAATAAGGAGATTTAGAAAACAATGATGCTTA
GACCATTTGTAGGCTAGGCTAAGCAGGCATAGACAACTTTTAGATGCTTCGGTTTTGATCAAGAAGGAACTGTGACCACAAAAATAGTCATTTTGTTGCT
CGTTTGTGTG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.941744
Expected error %
0.443002
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0148B07
Clone
Clone name
hba-148b7
LE_HBa0148B07
P148B07
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found