Clone Read LE_HBa0148B07_T7_101053

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0148B07_T7_101053
Primer
T7
ID from Seq. Facility
LE_HBa_148_B07-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
799 trimmed for vector and quality, 847 raw
Genbank Accession
Sequence
>LE_HBa0148B07_T7_101053 (raw untrimmed)
CCCGGACCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTATATTGTTCCCTCTTTTAGAATCCTGGTGGTTTAATCTTGAACAGACACATA
ATCTGAAATGAGAATATGCAGGATGATCGTGTTGCTACTGTGTGGCTCAACAATGCAGATGTTCGTAAAGCTATTCATGCAGAACAGACAACTGTGATAG
GTCCCTGGGAGCTATGCACAGACAAAATAACTATGTATCATGATTCTGGAAGCATGATTCCTTATCACAAAAATCTCACAGCTCGGGGCTATCGGGCAAT
CATATACAGGTTCAATAGATTACTAAGTCTCTTGACTTCTCTCTATGCATTTTTTTGTGATAATTTCGCTATCACAGTAATTATAACATGCTCTTCCACT
ATTCTCATGTTGCTGTAGGCTGCCTAAGGAAAATGTTGTTAGTGAACATGTACCTGATCACACACAAATTATCCGAGAACTTTTTTGATGCTATAACCAG
AAAAATTATGTTCATTTTTTGGTTTGTTGCAGTGGGGATCACGATATGTGTGTACCATACACTGGTTCAGCACTATGGACAAGATCTCTTGGATATCCGA
TCGTGGATGAATGGAGGCCTTGGTATGTGAATGAACAAGTTGCAGGGTATGTTCGCGTTCTAAATCCTCTTTATGGTTTAACTAGTGCTGTTGCAATTCT
GCAATATCCATTTCAAATGCTTTAATCTTTTGTGCATTTTCATACAAGGTTATGACAACAACCTCATTTTTATGACTTGTTAAGGTATGTTCATTATCCA
AGAAAAAACATTCATTTTTCCTGGTTTTTTCTTTTTTCCCTTTCTTA
>LE_HBa0148B07_T7_101053 (trimmed for quality and cloning vector)
AGCTTATATTGTTCCCTCTTTTAGAATCCTGGTGGTTTAATCTTGAACAGACACATAATCTGAAATGAGAATATGCAGGATGATCGTGTTGCTACTGTGT
GGCTCAACAATGCAGATGTTCGTAAAGCTATTCATGCAGAACAGACAACTGTGATAGGTCCCTGGGAGCTATGCACAGACAAAATAACTATGTATCATGA
TTCTGGAAGCATGATTCCTTATCACAAAAATCTCACAGCTCGGGGCTATCGGGCAATCATATACAGGTTCAATAGATTACTAAGTCTCTTGACTTCTCTC
TATGCATTTTTTTGTGATAATTTCGCTATCACAGTAATTATAACATGCTCTTCCACTATTCTCATGTTGCTGTAGGCTGCCTAAGGAAAATGTTGTTAGT
GAACATGTACCTGATCACACACAAATTATCCGAGAACTTTTTTGATGCTATAACCAGAAAAATTATGTTCATTTTTTGGTTTGTTGCAGTGGGGATCACG
ATATGTGTGTACCATACACTGGTTCAGCACTATGGACAAGATCTCTTGGATATCCGATCGTGGATGAATGGAGGCCTTGGTATGTGAATGAACAAGTTGC
AGGGTATGTTCGCGTTCTAAATCCTCTTTATGGTTTAACTAGTGCTGTTGCAATTCTGCAATATCCATTTCAAATGCTTTAATCTTTTGTGCATTTTCAT
ACAAGGTTATGACAACAACCTCATTTTTATGACTTGTTAAGGTATGTTCATTATCCAAGAAAAAACATTCATTTTTCCTGGTTTTTTCTTTTTTCCCTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.966545
Expected error %
1.46622
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g12910.1 Score 93 E Value 2e-19 Identity 61.30% Align. Length 664bp (83.10%) Frame 2
68417.m02019 serine carboxypeptidase S10 family protein SERINE CARBOXYPEPTIDASE I PRECURSOR - Hordeum vulgare, SWall:CBP1_HORVU
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g25420.1 Score 76 E Value 1e-15 Identity 56.50% Align. Length 664bp (83.10%) Frame 2
68416.m03161 serine carboxypeptidase S10 family protein similar to serine carboxypeptidase I precursor (SP:P37890) from [Oryza sativa]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAF44708.1| Score 120 E Value 5e-26 Identity 88.70% Align. Length 664bp (83.10%) Frame 2
wound-inducible carboxypeptidase [Lycopersicon esculentum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAA70816.1| Score 94 E Value 5e-18 Identity 67.20% Align. Length 564bp (70.59%) Frame 2
serine carboxypeptidase I, CP-MI [Hordeum vulgare subsp. vulgare] pir||CPBHS carboxypeptidase C (EC 3.4.16.5) precursor - barley sp|P07519|CBP1_HORVU Serine carboxypeptidase I precursor (Carboxypeptidase C) (CP-MI)
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0148B07
Clone
Clone name
hba-148b7
LE_HBa0148B07
P148B07
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found