Clone Read LE_HBa0148F24_T7_101279

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0148F24_T7_101279
Primer
T7
ID from Seq. Facility
LE_HBa_148_F24-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
603 trimmed for vector and quality, 802 raw
Genbank Accession
Sequence
>LE_HBa0148F24_T7_101279 (raw untrimmed)
GGACCCGGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTATTGTTCTTTTTATAAGAATAATCCTTTTAACGAGAATAGAAAAATAACTTAAA
AATTGATTAGAGATTTTATTTCACAAAAGTCTGTTAATATAAATCTAAGTTATTTGTGTTAAAAAAACAAACGAAGACTATACATTTTTAAATAGTTAAA
GAAATAAAATTGATAAGTGCATAATTAAGAGACGAATAAGTTTTAAATTCCTTAAAGGAATAAAACCGCTAAATTTATAGCCTGTGAACTAAAAGTAATA
AGCTTTTAAAGAAATTAAAGATGAAATCCAGTAAAATTATAGTTAGGGGTCATTTCAGACCTACTTGTTAAAGAGCTATACTTGGAGACGAAATTATGAA
TTTGAGGGTTTTAAAAAAATTGACAATGAAAACCCATAACTCTTGGGTGGAAAACATATTCAAAACCTCTTTTTTACCACTAAGGTGTCACTAAAGTAGG
GCCCACAGATTAATATAAATTTGTATACTTATTTAAATTTTACTATAAATAAAAAATAACAAAAGTTAAATAAAATAATATATCTCTTCACATTTTGATA
AATTTTACTTTGTAGAAATTGTCATGCTTTGTAATTTTTATTAGGTCTCTATGAGACCAAGATAAACTATTTCCATCATCTAGCAAGTAATAGGTACGAA
ATGATAAATCAATTAATGATTTTTATAATCCACTTTTATTCTAGGAAGTATTCTAAATCGGATTTACAGGATCAAGTTGTTTTTGTTATTATCTTTTAAT
TT
>LE_HBa0148F24_T7_101279 (trimmed for quality and cloning vector)
AGCTTATTGTTCTTTTTATAAGAATAATCCTTTTAACGAGAATAGAAAAATAACTTAAAAATTGATTAGAGATTTTATTTCACAAAAGTCTGTTAATATA
AATCTAAGTTATTTGTGTTAAAAAAACAAACGAAGACTATACATTTTTAAATAGTTAAAGAAATAAAATTGATAAGTGCATAATTAAGAGACGAATAAGT
TTTAAATTCCTTAAAGGAATAAAACCGCTAAATTTATAGCCTGTGAACTAAAAGTAATAAGCTTTTAAAGAAATTAAAGATGAAATCCAGTAAAATTATA
GTTAGGGGTCATTTCAGACCTACTTGTTAAAGAGCTATACTTGGAGACGAAATTATGAATTTGAGGGTTTTAAAAAAATTGACAATGAAAACCCATAACT
CTTGGGTGGAAAACATATTCAAAACCTCTTTTTTACCACTAAGGTGTCACTAAAGTAGGGCCCACAGATTAATATAAATTTGTATACTTATTTAAATTTT
ACTATAAATAAAAAATAACAAAAGTTAAATAAAATAATATATCTCTTCACATTTTGATAAATTTTACTTTGTAGAAATTGTCATGCTTTGTAATTTTTAT
TAG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.883431
Expected error %
1.74125
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0148F24
Clone
Clone name
hba-148f24
LE_HBa0148F24
P148F24
Clone type
BAC
Contamination
none
Estimated length
129,493
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found