Clone Read LE_HBa0148K12_T7_101495

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0148K12_T7_101495
Primer
T7
ID from Seq. Facility
LE_HBa_148_K12-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
392 trimmed for vector and quality, 872 raw
Genbank Accession
Sequence
>LE_HBa0148K12_T7_101495 (raw untrimmed)
ATGCGAGTAACCCGGGGGGGAACTCCCATGAATCGACCTGCATGCATGCAAGCTTCAATATACAGTGACCTGCATAAAGCCCTTTATACTAAATAATTCT
GATAGGAAATGGAACTATCAAGTCCATATATATGTAAAATAATATTGCAGTTTTTACCATCTCTTTGTACGTCCTAGCTGCGTATTTTTTTTTCAAGACC
TCAATTAAATCTTTGCCATAAAGGTAAGGCATGTTGGGCATCCCTGAAACAAAGATAAACCAAAATGTGTTCCGATTGATTGTTAATAGCTGCAGTTCAA
ATATAATTTTTCTTTGTCAAATAGTATAAATCAGATACAAGCGGTGGGATTACGAACTCACCAAGCACCCCTGGACCACCATGATCGGAGTAATACAAAA
ATATCCTGTCATTCGGTCCACTATTGACGACCTTCCCACTTCCACCTTTCACGGCACTTTTATCACCAAGTAGTACAGCATACAAGTTTGCTGCAGTGAC
GTGCTCACCGGTATAGTCCTACCATAATCATCTTATCAAATGTGAGACTACTGATGGCTAAAAAAAAGAAATGAATAACGTACCCTTTCCAAATAAATCA
ATTCCGCGAAAATAATGCAGAAGTACAAGAACCAAGCCTCTTATTTTTTTAAAATAGTATCCCAAACTATTTTGTGTTTCCACATTTCAATTTGTTCAAT
TCTCGCGAAAAAAATGGATAATTTCTAAAAACTAAACTTCATTTTTTTTCTAAAAATAATTAATTTTCTATTCTTGTGATTTCCACATTCCGCCCTGAAA
CTAGCCAAAAAATAAAGATAAAACTTGATAATTTGTTTCTGCATTTAATTAATAAATCTTACAAAATTGAGA
>LE_HBa0148K12_T7_101495 (trimmed for quality and cloning vector)
ACCTGCATGCATGCAAGCTTCAATATACAGTGACCTGCATAAAGCCCTTTATACTAAATAATTCTGATAGGAAATGGAACTATCAAGTCCATATATATGT
AAAATAATATTGCAGTTTTTACCATCTCTTTGTACGTCCTAGCTGCGTATTTTTTTTTCAAGACCTCAATTAAATCTTTGCCATAAAGGTAAGGCATGTT
GGGCATCCCTGAAACAAAGATAAACCAAAATGTGTTCCGATTGATTGTTAATAGCTGCAGTTCAAATATAATTTTTCTTTGTCAAATAGTATAAATCAGA
TACAAGCGGTGGGATTACGAACTCACCAAGCACCCCTGGACCACCATGATCGGAGTAATACAAAAATATCCTGTCATTCGGTCCACTATTGA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.961525
Expected error %
0.701425
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g62710.1 Score 48 E Value 2e-13 Identity 65.60% Align. Length 267bp (68.11%) Frame 1
68414.m07078 vacuolar processing enzyme beta / beta-VPE identical to SP|Q39044 Vacuolar processing enzyme, beta-isozyme precursor (EC 3.4.22.-) (Beta-VPE) {Arabidopsis thaliana}
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAA07639.1| Score 49 E Value 3e-12 Identity 65.60% Align. Length 270bp (68.88%) Frame 1
cysteine proteinase precursor [Vicia sativa] pir||T10944 cysteine proteinase (EC 3.4.22.-) precursor - spring vetch
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
pir||C96652 Score 48 E Value 1e-11 Identity 65.60% Align. Length 267bp (68.11%) Frame 1
protein F23N19.7 [imported] - Arabidopsis thaliana gb|AAF19550.1| F23N19.7 [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0148K12
Clone
Clone name
hba-148k12
LE_HBa0148K12
C08HBa0148K12
P148K12
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found