Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Clone Read LE_HBa0049M07_SP6_10188

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0049M07_SP6_10188
Primer
SP6
ID from Seq. Facility
LE_HBa_049_M07-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
777 trimmed for vector and quality, 943 raw
Genbank Accession
Sequence
>LE_HBa0049M07_SP6_10188 (raw untrimmed)
AAAAAAAAAAGGGCTNCCCCCATCTAGTGATCTGGAATTGACTTCTCATGAGAATGAATTGAGTTGATTGAAAATGTCGAACTGTCAATGATAACTTTGT
TTTTATCCTTGAAGCTCTTGAGATATCCAGTCTACAGCCATGCTGACTTGTCCTAATCCTTAAACAGATTTCCTTAGATAATCTTTCAACTTCCTCTCTC
ACTAGGCCTTTCGTTAGTGGATCTAATACATAATCACTTGACTTCACATAGTCAATGGTGATAATTCCACTAGAGATCAGTTGTCTTACAGTGTTATGTC
TTCGTCTTATATGACGAGACTTCGCGTTGTGCATAACGCGACCTGCCCTACCTATTGTTGGTTGACTATCGTAATGTATGTAGATAGGTACCACATGTTA
GGGCCTAAATGGAATATCTCTAGGAAATTTTGGAGCCATTCAAATTCTTCACTACCATTATCTAAAGCAATAAATTCAGATTCCATTGTGGAGCGTGTGG
TACATGTCTGTTAGGAAGATTTCCAAGAGACTACTCCTCCACCATGTGTAAATACATAACAACTTGTGGATTTTACTTTATTTTACCCGGTGATCCAATT
TGCATTAATGTATCATTCAATCAAAGCAGGATATTTATTATAATGCTAAACATAGTGTTGTGTATGTTTCAGATACCCCAACACATATTTCATTGTCATC
TAGTGAGTTTGATTCAAATTACTAGTGAAATGACTCAGTTTGCTAATAGCACATGCTATATCTGGTTGCATACGATTCGTAAAATGCATCAAACTTCCCA
ACACTCTAGCATATTCCAATTGAGAGTCACTTTTATCTTCATTCTTTTGAAATGTAAAGCTCAAGTCAATTGGATTTTTGACCATATTAAATTCAAAGTA
ATTGACTTATGCAATGTGCTTTCAATATATGAGATTGACACAA
>LE_HBa0049M07_SP6_10188 (trimmed for quality and cloning vector)
TTGACTTCTCATGAGAATGAATTGAGTTGATTGAAAATGTCGAACTGTCAATGATAACTTTGTTTTTATCCTTGAAGCTCTTGAGATATCCAGTCTACAG
CCATGCTGACTTGTCCTAATCCTTAAACAGATTTCCTTAGATAATCTTTCAACTTCCTCTCTCACTAGGCCTTTCGTTAGTGGATCTAATACATAATCAC
TTGACTTCACATAGTCAATGGTGATAATTCCACTAGAGATCAGTTGTCTTACAGTGTTATGTCTTCGTCTTATATGACGAGACTTCGCGTTGTGCATAAC
GCGACCTGCCCTACCTATTGTTGGTTGACTATCGTAATGTATGTAGATAGGTACCACATGTTAGGGCCTAAATGGAATATCTCTAGGAAATTTTGGAGCC
ATTCAAATTCTTCACTACCATTATCTAAAGCAATAAATTCAGATTCCATTGTGGAGCGTGTGGTACATGTCTGTTAGGAAGATTTCCAAGAGACTACTCC
TCCACCATGTGTAAATACATAACAACTTGTGGATTTTACTTTATTTTACCCGGTGATCCAATTTGCATTAATGTATCATTCAATCAAAGCAGGATATTTA
TTATAATGCTAAACATAGTGTTGTGTATGTTTCAGATACCCCAACACATATTTCATTGTCATCTAGTGAGTTTGATTCAAATTACTAGTGAAATGACTCA
GTTTGCTAATAGCACATGCTATATCTGGTTGCATACGATTCGTAAAATGCATCAAACTTCCCAACACTCTAGCATAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.956494
Expected error %
0.26426
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38766.1| Score 197 E Value 2e-76 Identity 74.20% Align. Length 771bp (99.23%) Frame 3
putative polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|XP_475988.1| Score 131 E Value 3e-42 Identity 48.90% Align. Length 655bp (84.30%) Frame 2
putative polyprotein [Oryza sativa (japonica cultivar-group)] gb|AAT44162.1| putative polyprotein [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0049M07
Clone
Clone name
hba-49m7
LE_HBa0049M07
C08HBa0049M07
P049M07
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found