Clone Read LE_HBa0156N23_SP6_102428

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0156N23_SP6_102428
Primer
SP6
ID from Seq. Facility
LE_HBa_156_N23-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
650 trimmed for vector and quality, 936 raw
Sequence
>LE_HBa0156N23_SP6_102428 (raw untrimmed)
AAAGTGGGGCGGGGGGGGCCATAAGCTACACAGAAACGTATTGTCTTTTGAGTCACTGTGTCAAAGGAGATGAAATGGATGAAAAAACCCTTTACAAACC
TTCTAGAGTATCCATACACCATTTGGTAAATTTAAAATAAGTTAGTAGTCAACCTCTTTTTCAAATCGTGAGAGCTTTTCTCACAAGCTTCAAACCATTG
AAACGTAATTGTCTTTTGAGTCAACTGTGTCAAAGGAGATGAAATGGATGAAAAAACCCTTAACAAACCTTCTAGAGTATCCATACAAATCCAAGAAACT
AATAAATATATTAGTTAGAGACGTGGGTCTAGGCAAAATCTGAATTGCTTCTATCTTTTGGGTATCAACTATATCCATCACTGGAAACTATGTGGCCCTA
GAATGCCACAAACTTAACCCAAACTCACATTTTGAGATCTTAGCATATAACTCCTTAACTTTCAAAGTCTAAGGAATATTACGTGGTGAATAGCATGATA
TTTTTCATTCCTTGAATAAATTAGTATGTCATTAATGAAGACGATAACAAACATAATTAGATAAGGTTTGAATACTCTATTCATAAGATCCATAAATGTT
GTACGCGCATTGGTTAACCCAAAGACACGACCAAAAACTCATAATTACCATATTTGGTTCTGAAAAGTTGTCTTTGGAATAACACATTCCCTAAATTTCC
AACTGATGGTAGCTTAAAATTAAATCAAATTTCCAGAAATAGGAAAAACCCTGAAGCTGGTCGAGAGATCATCAACCATTGGAAGAGAAAATTTATTTCT
GAAGGGAACCTTGTCCAATTGGAGGGAAAATTAACCACCCTAAGGGATTCATTCTTCTTTCTCCCATTATGGATGGACCCCCCAAGGTGAAACATTGGGG
AAAGTAACCCCTAATCACCAAACCTTCCACTTTTAC
>LE_HBa0156N23_SP6_102428 (trimmed for quality and cloning vector)
TTGTCTTTTGAGTCACTGTGTCAAAGGAGATGAAATGGATGAAAAAACCCTTTACAAACCTTCTAGAGTATCCATACACCATTTGGTAAATTTAAAATAA
GTTAGTAGTCAACCTCTTTTTCAAATCGTGAGAGCTTTTCTCACAAGCTTCAAACCATTGAAACGTAATTGTCTTTTGAGTCAACTGTGTCAAAGGAGAT
GAAATGGATGAAAAAACCCTTAACAAACCTTCTAGAGTATCCATACAAATCCAAGAAACTAATAAATATATTAGTTAGAGACGTGGGTCTAGGCAAAATC
TGAATTGCTTCTATCTTTTGGGTATCAACTATATCCATCACTGGAAACTATGTGGCCCTAGAATGCCACAAACTTAACCCAAACTCACATTTTGAGATCT
TAGCATATAACTCCTTAACTTTCAAAGTCTAAGGAATATTACGTGGTGAATAGCATGATATTTTTCATTCCTTGAATAAATTAGTATGTCATTAATGAAG
ACGATAACAAACATAATTAGATAAGGTTTGAATACTCTATTCATAAGATCCATAAATGTTGTACGCGCATTGGTTAACCCAAAGACACGACCAAAAACTC
ATAATTACCATATTTGGTTCTGAAAAGTTGTCTTTGGAATAACACATTCC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.940931
Expected error %
0.260598
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAV31191.1| Score 116 E Value 5e-25 Identity 15.20% Align. Length 545bp (83.85%) Frame 3
putative polyprotein [Solanum tuberosum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAV31171.1| Score 110 E Value 2e-23 Identity 14.90% Align. Length 536bp (82.46%) Frame 3
putative polyprotein [Solanum tuberosum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0156N23
Clone
Clone name
hba-156n23
LE_HBa0156N23
P156N23
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found