Clone Read LE_HBa0156N23_T7_102429

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0156N23_T7_102429
Primer
T7
ID from Seq. Facility
LE_HBa_156_N23-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
649 trimmed for vector and quality, 924 raw
Sequence
>LE_HBa0156N23_T7_102429 (raw untrimmed)
TCCAGCGGGGCCCCGGGGGATCCTCTAGAGTCGACCTGCAGGCGTGCAAGCTTGTTATTTTCTGCTTTTGTTTGCTATCTATCTCTTTATTTTATTATTC
TTTTTTATTTGTGTATTTGTTAGTCAGACCTGTCTTTACTGTGTTAGGTGAAATATTTTATTGAATGATCTATTTTTTGAAGATTAGGTAATGTATTATA
TGTTTTTGCATATGTAAAGATTTTCTTTGAAGCATCTGGTCCCTATTCCTTTACTCTTGGTAGAGTTCTTTATTTTTTTAATGTTCTGTTGTTGTCTAAT
ACGACCTTTTTCTCTTTACTTTTTGTCTATAATGTCCCATCAATGGTCAACAAGGTAGACCTATTATTCTGTTATGGGGCAAGTAGGTATTGACACCTAG
AATTATTTACATTAAATAATTGACTCGTGTTTGGAAGGAGTATGGTCCAGATTTATTGTCATATATAAACATATGTGAATTTTATGAAAAGTTAAATTTT
AGTAAGGTCCAACAACTTCTACTCAAAGGATTTTCTGGGAGGCATTATTTGATTGAAGACTATTCTAGCATAAGAACACTTCAAAAGGCATTGTTTGTTT
AAGTTCGGTGTACTTGAACTGTTTTTTGTAGATGAGGGGATGATGTTGTTCCACCTATTGACATTAGCCACTATATTGAACCCGACCCTAGCCCATGGAA
GATGTTGCATGGAAGGTTAATCAACTGTGGAATAAAGATGGAATTGAACCTTATCTACTTCTGTAGATGCTCCTACTATAAGGTGAATCAATCACGCATA
ACATTAGAAAATGACCTTATCCCAACCACCACAAAGAAAATAATAGAATACCCTAAGGTTGAAACGAAAAAGAATACAAGTCAACTGGCCCAGTCAACCT
TAGTAAAATTCATACCCTACCAAT
>LE_HBa0156N23_T7_102429 (trimmed for quality and cloning vector)
AGCTTGTTATTTTCTGCTTTTGTTTGCTATCTATCTCTTTATTTTATTATTCTTTTTTATTTGTGTATTTGTTAGTCAGACCTGTCTTTACTGTGTTAGG
TGAAATATTTTATTGAATGATCTATTTTTTGAAGATTAGGTAATGTATTATATGTTTTTGCATATGTAAAGATTTTCTTTGAAGCATCTGGTCCCTATTC
CTTTACTCTTGGTAGAGTTCTTTATTTTTTTAATGTTCTGTTGTTGTCTAATACGACCTTTTTCTCTTTACTTTTTGTCTATAATGTCCCATCAATGGTC
AACAAGGTAGACCTATTATTCTGTTATGGGGCAAGTAGGTATTGACACCTAGAATTATTTACATTAAATAATTGACTCGTGTTTGGAAGGAGTATGGTCC
AGATTTATTGTCATATATAAACATATGTGAATTTTATGAAAAGTTAAATTTTAGTAAGGTCCAACAACTTCTACTCAAAGGATTTTCTGGGAGGCATTAT
TTGATTGAAGACTATTCTAGCATAAGAACACTTCAAAAGGCATTGTTTGTTTAAGTTCGGTGTACTTGAACTGTTTTTTGTAGATGAGGGGATGATGTTG
TTCCACCTATTGACATTAGCCACTATATTGAACCCGACCCTAGCCCATG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.921512
Expected error %
1.02051
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT39304.1| Score 84 E Value 4e-15 Identity 20.40% Align. Length 215bp (33.13%) Frame 1
putative transposon MuDR mudrA-like protein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0156N23
Clone
Clone name
hba-156n23
LE_HBa0156N23
P156N23
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found