Clone Read LE_HBa0156O14_SP6_102458

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0156O14_SP6_102458
Primer
SP6
ID from Seq. Facility
LE_HBa_156_O14-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
701 trimmed for vector and quality, 818 raw
Sequence
>LE_HBa0156O14_SP6_102458 (raw untrimmed)
CATTATTAAGGCAAGAAAACATTTACAAGGGGCGGGTTTTATGAGGGAATCATGATTGTTGGAGAATTCGCCCGTTTGAAAGTCCAAGAAGCAAAAGGTC
TGATCAGGAGCAACCTTTTGGAGTCAAATCAAGCTGTAGTATATAGTGAACCTGAGAAAAAAGTCATGTCGCGATCCGGGGATGAGTGTGTTGTGGCTTT
GACTGATCAATGGTATATCACTTATGGAGAATCAGAATGGAGGAAGGCTGCAGAGGAGTGTCTGGCCAATATGAATCTCTACTCTGATGAGACACGACAT
GGCTTTGAGCACACTCTCAGCTGGCTTAATCAGTGGGCTTGTTCTCGCAGTTTTGGGCTTGGAACTCGTATTCCTTGGGATGAGGAATTCTTAGTTGAGT
CCTTGTCCGATTCCACTATTTATATGGCATATTACACAGTGGCACACTTCTTGCAGAAAGGGGACATGTATGGTAATGATCGTTCTTCAGTGAAACCAGA
GCACTTGACAGATGAGGTCTGGGAATTCTTGTTCTGTGATGGGCCTTTCCCTCACAATTCTTATATATCTTCTTCTCTTCTAAAGGAGATGAAGCAGCAA
TTTCTCTACTGGTATCCATTCGATCTTAGAGTTTCTGGCAAGGATCTTATTCAGAATCATCTTAGCTTTTGCATCTATCACCACACTGCCCTCTTCCCTA
AGCACCACTGGCCACGTGGTTTAAGATGCAATGGGCATATAATGCTTAACTCTGAGAAAATGTCTAAGTCCACTGGGAATTTCCGAAACACTCCGGCCGG
GAAATTGAAAAATTTTCA
>LE_HBa0156O14_SP6_102458 (trimmed for quality and cloning vector)
ATTTACAAGGGGCGGGTTTTATGAGGGAATCATGATTGTTGGAGAATTCGCCCGTTTGAAAGTCCAAGAAGCAAAAGGTCTGATCAGGAGCAACCTTTTG
GAGTCAAATCAAGCTGTAGTATATAGTGAACCTGAGAAAAAAGTCATGTCGCGATCCGGGGATGAGTGTGTTGTGGCTTTGACTGATCAATGGTATATCA
CTTATGGAGAATCAGAATGGAGGAAGGCTGCAGAGGAGTGTCTGGCCAATATGAATCTCTACTCTGATGAGACACGACATGGCTTTGAGCACACTCTCAG
CTGGCTTAATCAGTGGGCTTGTTCTCGCAGTTTTGGGCTTGGAACTCGTATTCCTTGGGATGAGGAATTCTTAGTTGAGTCCTTGTCCGATTCCACTATT
TATATGGCATATTACACAGTGGCACACTTCTTGCAGAAAGGGGACATGTATGGTAATGATCGTTCTTCAGTGAAACCAGAGCACTTGACAGATGAGGTCT
GGGAATTCTTGTTCTGTGATGGGCCTTTCCCTCACAATTCTTATATATCTTCTTCTCTTCTAAAGGAGATGAAGCAGCAATTTCTCTACTGGTATCCATT
CGATCTTAGAGTTTCTGGCAAGGATCTTATTCAGAATCATCTTAGCTTTTGCATCTATCACCACACTGCCCTCTTCCCTAAGCACCACTGGCCACGTGGT
T

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.976426
Expected error %
0.595594
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g09620.1 Score 373 E Value 1e-104 Identity 24.50% Align. Length 686bp (97.86%) Frame 3
68414.m01079 tRNA synthetase class I (I, L, M and V) family protein similar to cytosolic leucyl-tRNA synthetase [Candida albicans] GI:9858190; contains Pfam profile PF00133: tRNA synthetases class I (I, L, M and V)
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_172433.1| Score 373 E Value 1e-102 Identity 24.50% Align. Length 686bp (97.86%) Frame 3
tRNA synthetase class I (I, L, M and V) family protein [Arabidopsis thaliana] gb|AAB60719.1| Strong similarity to S. pombe leucyl-tRNA synthetase (gb|Z73100). [Arabidopsis thaliana] pir||H86229 hypothetical protein [imported] - Arabidopsis thaliana
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAD95115.1| Score 363 E Value 2e-99 Identity 24.50% Align. Length 668bp (95.29%) Frame 3
putative leucyl-tRNA synthetase [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0156O14
Clone
Clone name
hba-156o14
LE_HBa0156O14
C02HBa0156O14
P156O14
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found