Clone Read LE_HBa0156P05_T7_102489

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0156P05_T7_102489
Primer
T7
ID from Seq. Facility
LE_HBa_156_P05-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
634 trimmed for vector and quality, 968 raw
Sequence
>LE_HBa0156P05_T7_102489 (raw untrimmed)
CTAGGCCTGGTCCCGGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCTCTCTCTCACTACCATTTTTTTTTTTGAATTCTTCATCCATATTGA
TGTTTACTGCAAAATGTGCATTTGCTTCAGCTTGAACTTCAGCTTGAGCTGGATTGTTAATGGCATCATCATCATCATCGAAAGGGAGAAGCAGTTCACC
ATCTCATTACCGTAAACCTTCAACTCCTTACTCTTCATCTTCTTCATCTTCATCTTCAATCATGAACGGTCGGATGTTGCCACGATCATATTCTTCATCA
ACGACGTCTTTTTATGGCTCTGGGAATAGCTACAATTCCAGATCCATGACTCCGAGTCATAGTCGTTCCGATTCGGTGTACTCACAAGGTTATGAAAATC
GTACGCCGGTGAGTTATCCATCCGAAGAGGAGTTGATTGATGAGCCAGCTGATGAGTCTAGATCCGGAGATAGTATTTCTGTGACGGTTAGGTTTCGGCC
AATGAGGTGAGTTTTGGATCTGGTTTAACTAATTTTAGATGTAGGTACAGCTGAAGTTTAGGGGACAATGTAGTTAGTATTTGAATTGGTCTGATTATGG
TGACCAGGAACGAGAATATCATAAGGGCGATGAAATTGCGTGGTATGCAGATGGTGGTAAAACTGTGCGGAACGAGTATAATCCACCATCAGCTTATGCC
CTTTGGTACATTCTAGGCTCATTTGGCTTTATCTTAATTCTGATTCTACTACCTGTGGAAATCTCCTCTCTCTTCTGGGAATAATGCTTATTCTTTAGAT
GGGTTGGAACGGTCTGGTTCCGGAAATGAATTATGACAGAAATATACTGATGACATTTGGAAGTTTACCCCGTAAGAGACTAGTAAGCAATGTATCGCGC
TCTAGGCAAAACGCTGCCTCTCTTAGATCTCTACTGTTCCGCTTGGGTCACTTACCCTCCTTGATTGT
>LE_HBa0156P05_T7_102489 (trimmed for quality and cloning vector)
AGCTTCTCTCTCTCACTACCATTTTTTTTTTTGAATTCTTCATCCATATTGATGTTTACTGCAAAATGTGCATTTGCTTCAGCTTGAACTTCAGCTTGAG
CTGGATTGTTAATGGCATCATCATCATCATCGAAAGGGAGAAGCAGTTCACCATCTCATTACCGTAAACCTTCAACTCCTTACTCTTCATCTTCTTCATC
TTCATCTTCAATCATGAACGGTCGGATGTTGCCACGATCATATTCTTCATCAACGACGTCTTTTTATGGCTCTGGGAATAGCTACAATTCCAGATCCATG
ACTCCGAGTCATAGTCGTTCCGATTCGGTGTACTCACAAGGTTATGAAAATCGTACGCCGGTGAGTTATCCATCCGAAGAGGAGTTGATTGATGAGCCAG
CTGATGAGTCTAGATCCGGAGATAGTATTTCTGTGACGGTTAGGTTTCGGCCAATGAGGTGAGTTTTGGATCTGGTTTAACTAATTTTAGATGTAGGTAC
AGCTGAAGTTTAGGGGACAATGTAGTTAGTATTTGAATTGGTCTGATTATGGTGACCAGGAACGAGAATATCATAAGGGCGATGAAATTGCGTGGTATGC
AGATGGTGGTAAAACTGTGCGGAACGAGTATAAT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.971367
Expected error %
0.773739
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g39050.1 Score 60 E Value 2e-16 Identity 39.20% Align. Length 468bp (73.82%) Frame 2
68417.m05531 kinesin-related protein (MKRP2) kinesin motor protein - Ustilago maydis, PID:g2062750; identical to cDNA MKRP2 mRNA for kinesin-related protein GI:16902293, kinesin-related protein [Arabidopsis thaliana] GI:16902294
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g21380.1 Score 59 E Value 1e-16 Identity 34.30% Align. Length 474bp (74.76%) Frame 2
68415.m02544 kinesin motor protein-related
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAB80568.1| Score 62 E Value 1e-14 Identity 39.80% Align. Length 468bp (73.82%) Frame 2
kinesin like protein [Arabidopsis thaliana] emb|CAB38825.1| kinesin like protein [Arabidopsis thaliana] pir||T06065 hypothetical protein F19H22.150 - Arabidopsis thaliana
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAN13032.1| Score 60 E Value 7e-15 Identity 39.20% Align. Length 468bp (73.82%) Frame 2
putative kinesin protein [Arabidopsis thaliana] ref|NP_195616.2| kinesin-related protein (MKRP2) [Arabidopsis thaliana] dbj|BAB71852.1| kinesin-related protein [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0156P05
Clone
Clone name
hba-156p5
LE_HBa0156P05
P156P05
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found