Clone Read LE_HBa0158L12_T7_103079

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0158L12_T7_103079
Primer
T7
ID from Seq. Facility
LE_HBa_158_L12-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
502 trimmed for vector and quality, 813 raw
Genbank Accession
Sequence
>LE_HBa0158L12_T7_103079 (raw untrimmed)
GGGCTAACTCGTACCGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTACCCCTTCACTTAGATAGTTATGCCTTTATGAAATGACTAGTAGATA
AGCAGGAATCACTTCTGACCCTCACATGTTGAAAAAAGTAAAAGGCCCTGAGACCAAAATAGACAATTTGACCTCAAGGAGATATAAGCTCTGCTCTAAG
GATAAATGCAGAACAGAAGACCTTCTTGTGGATGGCCTGTATGTGCTCTTTTTTTTCTTTTTTTTTGGAACTATCGATATCATGAGTGCAAAGAATACTA
CCTTGCGGAGAATTTTCCAGATCAATAGCAGGACAGCTAGTATTATTGCCTTAAACTGTGTTTAGATTGAGCAAACGATGTTAACTAGTCATGCAGATGC
TTTTTTCAGCTTCTAGTGATGATACCAGCATGGGTAACTTTGTGTAGTACTAAAGGATTGAAGTTTCTGTAATGTTTCCGAAGTTCTCTGCCAAGAATAA
ATCTGTTTCATCATCATTTCATTTAGATTAAAATTGTGAACTCCTCCCTTTCTACCACAGTAAAATTGGTGGCAAGAACATGACTTTGGGGTTTTTGTCC
TCCTGTACATGGAATTCCTACTTCCCCACTTGCTGCTCATCTAACCATAAAATAGGAAAATATTCCACTAATACATAAATCCACAACCCTTTCCTCGTCG
CTACTATCCCTCTCCTAACTCTTTACTCCCTCGTTCACTCCCTTCACTCTCTCCTTTAGTTATTGGTTTTTTTTATTTTAGTCTTTCCATATTTCTTGCC
TCCCTAATGTCAC
>LE_HBa0158L12_T7_103079 (trimmed for quality and cloning vector)
AGCTTTACCCCTTCACTTAGATAGTTATGCCTTTATGAAATGACTAGTAGATAAGCAGGAATCACTTCTGACCCTCACATGTTGAAAAAAGTAAAAGGCC
CTGAGACCAAAATAGACAATTTGACCTCAAGGAGATATAAGCTCTGCTCTAAGGATAAATGCAGAACAGAAGACCTTCTTGTGGATGGCCTGTATGTGCT
CTTTTTTTTCTTTTTTTTTGGAACTATCGATATCATGAGTGCAAAGAATACTACCTTGCGGAGAATTTTCCAGATCAATAGCAGGACAGCTAGTATTATT
GCCTTAAACTGTGTTTAGATTGAGCAAACGATGTTAACTAGTCATGCAGATGCTTTTTTCAGCTTCTAGTGATGATACCAGCATGGGTAACTTTGTGTAG
TACTAAAGGATTGAAGTTTCTGTAATGTTTCCGAAGTTCTCTGCCAAGAATAAATCTGTTTCATCATCATTTCATTTAGATTAAAATTGTGAACTCCTCC
CT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.959852
Expected error %
0.576608
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0158L12
Clone
Clone name
hba-158l12
LE_HBa0158L12
C03HBa0158L12
P158L12
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found