Clone Read LE_HBa0049O20_SP6_10310

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0049O20_SP6_10310
Primer
SP6
ID from Seq. Facility
LE_HBa_049_O20-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
843 trimmed for vector and quality, 896 raw
Genbank Accession
Sequence
>LE_HBa0049O20_SP6_10310 (raw untrimmed)
TCCCTAAATTCCACTACAATTTCTTAATTTTTAGACACCGCTTTCTCCCTTTAGGCAAAACTTATTGATCTTGTCACCAATGGGACAAGCCAGGTAATTT
GAACAACCCAAAAAGGTAGATTTAGACTCTACGTGATAAAAAAAATTAGCGAAGATAGAAAGTACTCAACCATAAACAGCAATACATTAATTAAGTAGGA
TAGTTAGCTAGTTAGCCCCTTATTCAAGCTCATGATTCAATCAACCAATAGGAGATTAGGGAGCCCCATTTCGAGAGAATGGCTACAGTCATAGGAGCTA
CTTGTGTTAGCACATGCTCGAATAACTATGCACATTCTTTACCAACTTTTTTAAGGGTTTTTCTCTCGGTAGAAAAGATTAGAGTTCTAGAAACAAGATA
TAAAAGCTCACACACCAAAACCTAAATTGCTTTCATTAGAGCATTATTCCCATGATCAGTGCTCGAACTCTAAATTAGGAAAATCCTTCCTATTTCCAAA
ATTAAACTGTCTGACTAACTGCCATCCAAAACAGTTTTCAGAAACCTACTATATCCATTCACTCAAATCACAATTTTGACCTCTTGTCTTCTTTGAACAA
AACTTGTTGATCACATTTCCAACTACACAAGCTAGGCGAAAACGAAAAATTCAATACGATACCCCTAACACTTCTATTGTAAAAATCACTGGATTAAAAA
ATTGATCATCGTTTTTAACTTTTAACCCATACTCGCCCTTTCCGCAAAACTTCATAAAAAAAAACTTAACACCACCCCCACTTCCGTGACAATTTTTGTA
TATCACACATATCATATTGATTACTCTACCAGAAAACCTTGCTACAGCAAACAAAAAATCATAATTTACATTTCTCCGAAATCATGAAAAAGAAAT
>LE_HBa0049O20_SP6_10310 (trimmed for quality and cloning vector)
TTAATTTTTAGACACCGCTTTCTCCCTTTAGGCAAAACTTATTGATCTTGTCACCAATGGGACAAGCCAGGTAATTTGAACAACCCAAAAAGGTAGATTT
AGACTCTACGTGATAAAAAAAATTAGCGAAGATAGAAAGTACTCAACCATAAACAGCAATACATTAATTAAGTAGGATAGTTAGCTAGTTAGCCCCTTAT
TCAAGCTCATGATTCAATCAACCAATAGGAGATTAGGGAGCCCCATTTCGAGAGAATGGCTACAGTCATAGGAGCTACTTGTGTTAGCACATGCTCGAAT
AACTATGCACATTCTTTACCAACTTTTTTAAGGGTTTTTCTCTCGGTAGAAAAGATTAGAGTTCTAGAAACAAGATATAAAAGCTCACACACCAAAACCT
AAATTGCTTTCATTAGAGCATTATTCCCATGATCAGTGCTCGAACTCTAAATTAGGAAAATCCTTCCTATTTCCAAAATTAAACTGTCTGACTAACTGCC
ATCCAAAACAGTTTTCAGAAACCTACTATATCCATTCACTCAAATCACAATTTTGACCTCTTGTCTTCTTTGAACAAAACTTGTTGATCACATTTCCAAC
TACACAAGCTAGGCGAAAACGAAAAATTCAATACGATACCCCTAACACTTCTATTGTAAAAATCACTGGATTAAAAAATTGATCATCGTTTTTAACTTTT
AACCCATACTCGCCCTTTCCGCAAAACTTCATAAAAAAAAACTTAACACCACCCCCACTTCCGTGACAATTTTTGTATATCACACATATCATATTGATTA
CTCTACCAGAAAACCTTGCTACAGCAAACAAAAAATCATAATT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.945572
Expected error %
0.159813
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0049O20
Clone
Clone name
hba-49o20
LE_HBa0049O20
P049O20
Clone type
BAC
Contamination
none
Estimated length
110,778
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found