Clone Read LE_HBa0049O20_T7_10311

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0049O20_T7_10311
Primer
T7
ID from Seq. Facility
LE_HBa_049_O20-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
814 trimmed for vector and quality, 866 raw
Genbank Accession
Sequence
>LE_HBa0049O20_T7_10311 (raw untrimmed)
TTGACCTGGGACCGGGGGGTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGACAAGGTTTGGGTGTTGTAGAGCTGAAATCATGCCTATCTCATTGAC
AAATTCACGATTTCCTTGCTTTGACTTGGAAGACAGCTGCTTAACAGCTATGATGGCACCATCGGCGAGTACACCCTACAGATAGCAATATTCACAACAA
TCATATTACAGACAGAAGAAGGATATGAGTTACTTCAATTATTACTACTCTATTTTTCCTATAAACATGACATCGAGGATAACCAGTAGGAAATATCACC
AAAAAACCGCAAGCTGTCCTTATGCAAAATCAGTATGGATAGAGAATTGATACCTTGTAAACTGGTCCAAACCCTCCTTCACCAATTTTGTTGGCAGGAT
CAAAGTTATTAGTAGCAGCTTTAATTTGTCTAAGTCTAAAATGACCTGTTTGTAAATCAAGGGCTCTGAGTTCTGTAAACGAGATGAACATTGCAAACGT
CAGTATATATAGATCTTCTAAAACATCTGTATGATGAAAAACAACTTTTAAAAGAATGAACATCTGTATGACGAAGACAGTTTAAGACGTCATGAGCATT
TAATCGTGTGCTAAGTATCTATGATACGACATGATGTCGATCCACCAACAGAACAATCATCTCAATGCCGGTCAATTACAGGGAGATAATTATTTGTATC
TCACGGCTAGAAATCTCGTAAATGATTCTGATTATCACAACAGAACTATCGCCATATTATCAAATATAGAGAGTGAATAAAGTCTTTGAGATATGTATTA
CCTAATTCTTCTTGGTTATTTTTCCTCCAAAAATGCCTTTCTTCCCAGAGCAATTAAACTAGCAGA
>LE_HBa0049O20_T7_10311 (trimmed for quality and cloning vector)
AGCTTGACAAGGTTTGGGTGTTGTAGAGCTGAAATCATGCCTATCTCATTGACAAATTCACGATTTCCTTGCTTTGACTTGGAAGACAGCTGCTTAACAG
CTATGATGGCACCATCGGCGAGTACACCCTACAGATAGCAATATTCACAACAATCATATTACAGACAGAAGAAGGATATGAGTTACTTCAATTATTACTA
CTCTATTTTTCCTATAAACATGACATCGAGGATAACCAGTAGGAAATATCACCAAAAAACCGCAAGCTGTCCTTATGCAAAATCAGTATGGATAGAGAAT
TGATACCTTGTAAACTGGTCCAAACCCTCCTTCACCAATTTTGTTGGCAGGATCAAAGTTATTAGTAGCAGCTTTAATTTGTCTAAGTCTAAAATGACCT
GTTTGTAAATCAAGGGCTCTGAGTTCTGTAAACGAGATGAACATTGCAAACGTCAGTATATATAGATCTTCTAAAACATCTGTATGATGAAAAACAACTT
TTAAAAGAATGAACATCTGTATGACGAAGACAGTTTAAGACGTCATGAGCATTTAATCGTGTGCTAAGTATCTATGATACGACATGATGTCGATCCACCA
ACAGAACAATCATCTCAATGCCGGTCAATTACAGGGAGATAATTATTTGTATCTCACGGCTAGAAATCTCGTAAATGATTCTGATTATCACAACAGAACT
ATCGCCATATTATCAAATATAGAGAGTGAATAAAGTCTTTGAGATATGTATTACCTAATTCTTCTTGGTTATTTTTCCTCCAAAAATGCCTTTCTTCCCA
GAGCAATTAAACTA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.965565
Expected error %
0.478435
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g53440.1 Score 77 E Value 1e-14 Identity 92.90% Align. Length 423bp (51.97%) Frame 1
68414.m06057 leucine-rich repeat family protein / protein kinase family protein contains Pfam domains PF00560: Leucine Rich Repeat and PF00069: Protein kinase domain
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g53430.1 Score 77 E Value 1e-14 Identity 92.90% Align. Length 423bp (51.97%) Frame 1
68414.m06056 leucine-rich repeat family protein / protein kinase family protein contains Pfam domains PF00560: Leucine Rich Repeat and PF00069: Protein kinase domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAF78445.1| Score 77 E Value 5e-13 Identity 92.90% Align. Length 423bp (51.97%) Frame 1
Contains a weak similarity to disease resistance protein (cf-5) gene from Lycopersicon esculentum gb|AF053993 and contains multiple leucine rich PF|00560 repeats and protein kinase PF|00069 domain. EST gb|T04455 comes from this gene. [Arabidopsis thaliana] pir||D96574 hypothetical protein T3F20.24 [imported] - Arabidopsis thaliana
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_175748.1| Score 77 E Value 5e-13 Identity 92.90% Align. Length 423bp (51.97%) Frame 1
leucine-rich repeat family protein / protein kinase family protein [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0049O20
Clone
Clone name
hba-49o20
LE_HBa0049O20
P049O20
Clone type
BAC
Contamination
none
Estimated length
110,778
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found