Clone Read LE_HBa0162B13_T7_103369

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0162B13_T7_103369
Primer
T7
ID from Seq. Facility
LE_HBa_162_B13-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
501 trimmed for vector and quality, 871 raw
Sequence
>LE_HBa0162B13_T7_103369 (raw untrimmed)
TCTGGCCCCGGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTACTCAGGTTCTCTCTCAATTCATCGCTTTAATCATATTTGGTTGCTGCAAA
GTGAATATAGGAATACAATGTCAAGCCCTACTAAAGAAAATAGATAGAACAAGAGAGTACACCAGTTACTACATGATAGTGTAAAAGACCCGCCTCCCTA
CATCATATGCAGACTGAGCTCTGGCCAATTCAGATTAAAAATTTTCCATGAAGCTCTTCACATAAATAGCATATTAGAAAATGAACATTGGGCCTAGAGC
AAATCCAAAAGTTAGCTCATGATGTGAAGATTTCCCAATACCATATTAGAACACTCATTCCCCTTTCTATCTGTTCTCTACTAATATTGTTCTCTTTTTA
TATTTTGGATTTATTTTCTTTTATTTGTTGAAGTAAGAATTGATCGCTCTCTTTCTTCCGACATAGTTATTTAATACTTTCATATCTATGTTCCGTGTCT
ACAAGTGCATTGGTCTGAAGCAGGAAAAAAGGTTCTTTTACGCTGAATAACGTTCGAAAACTTGTTGTGTGTGAACATGAACAGTCCCATGCAATTCGTC
CTCGGTGCATTGAGTCCTCTCCCGGGCGTGGGACCCTCAATGTGAACTACCTCTTGTTTGCAAAATTCATTCGGTGCTGTCGTGTGAAATTCGGTAGGTG
TGTTGTGTTGGCGTCGGTTATCGTCGTATTATAACAATTTTGTCTGGGTATTTTGTAGTGAGTGTCGAAGACACGCTTGTTCGCATGCCTCTTTTTCACC
CCTGGATTACTGGAGGCTCTGGATTCGATAAGTGCTGTGGCAATGTTTTTGCTGTGATGTGTTTGTTTTTT
>LE_HBa0162B13_T7_103369 (trimmed for quality and cloning vector)
AGCTTACTCAGGTTCTCTCTCAATTCATCGCTTTAATCATATTTGGTTGCTGCAAAGTGAATATAGGAATACAATGTCAAGCCCTACTAAAGAAAATAGA
TAGAACAAGAGAGTACACCAGTTACTACATGATAGTGTAAAAGACCCGCCTCCCTACATCATATGCAGACTGAGCTCTGGCCAATTCAGATTAAAAATTT
TCCATGAAGCTCTTCACATAAATAGCATATTAGAAAATGAACATTGGGCCTAGAGCAAATCCAAAAGTTAGCTCATGATGTGAAGATTTCCCAATACCAT
ATTAGAACACTCATTCCCCTTTCTATCTGTTCTCTACTAATATTGTTCTCTTTTTATATTTTGGATTTATTTTCTTTTATTTGTTGAAGTAAGAATTGAT
CGCTCTCTTTCTTCCGACATAGTTATTTAATACTTTCATATCTATGTTCCGTGTCTACAAGTGCATTGGTCTGAAGCAGGAAAAAAGGTTCTTTTACGCT
G

This is probably not a useful sequence.

Problems:
  • High predicted error rate
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.954176
Expected error %
3.56173
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0162B13
Clone
Clone name
hba-162b13
LE_HBa0162B13
P162B13
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found