Clone Read LE_HBa0162B16_T7_103375

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0162B16_T7_103375
Primer
T7
ID from Seq. Facility
LE_HBa_162_B16-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
382 trimmed for vector and quality, 899 raw
Genbank Accession
Sequence
>LE_HBa0162B16_T7_103375 (raw untrimmed)
GGGGGGATCCTCCTGAAGTCGACCTGCAGGCATGCAAGCTTTAAATTGTTTTTAAACATAAAACACATTTACTCTTCAGTCTAATGAAATAAACCCAGCA
TATTCTGGTGTAGGCATCCTTTAAGAGGAGAATGTATTTGTTACCACTCTATGAATCTATATTTATTTGGCCACAAACATCCGTATGAATGAGATGATCA
AGTTTCTGGGTAGCTCTGCGTACTTGATTTACTTGAAATGACAATTTTGTCTTCTTTCCCTATTTGCATGTTTCACAAACTTGAGCATTAGAAAGAAAGT
CAGATATATTTTCCACTAGCTCCTTCTGTCTCATCTCTGTGATGCTTCTCATATTGAACTGACCAAACCTTTTGTGCTATAAGTTTGTACATTTGTATGA
AGTAATAATGTTAGCTTGCTCATTTGTTTTTCCCAAATAACTAAAAATATTTTGTTGCTCTTCCTTACATATAATAATTTCTATCCAAAAAGGTTGAGAA
ACAACACGTTTCATGTTTCATAACATGAATATGAGTAATTTATTATCCTCGCCTTCGTATCCACACTCCATCCATCTTCGCCTTGTGGTTAGTGTGCGGT
ACAGAAACTTCCTCAACTACTTATGGTTCTTTGCTTATTTGTTTGTATTTGCACTATTTGCTCTCGTCTCCTTTGGGGCGCATAGTGTCCCTCCTTGCTT
TCCCATACCTTTCCTCTCTTGTTTTTTTTTAATGTACCTTCATAATGCATTTTACTACCTTTCGCTCTAGCTCTCCTTATATTCTATATTCTCTCTCTAC
TTTCCTATACCTTTCTTTCTCACAGCACTATTACACTTACTCTCCTTACTTTACTTTTCATCTCCTTCTTGTTTTCTTATTTTTTTTTTTTCTAACTTC
>LE_HBa0162B16_T7_103375 (trimmed for quality and cloning vector)
ACCTGCAGGCATGCAAGCTTTAAATTGTTTTTAAACATAAAACACATTTACTCTTCAGTCTAATGAAATAAACCCAGCATATTCTGGTGTAGGCATCCTT
TAAGAGGAGAATGTATTTGTTACCACTCTATGAATCTATATTTATTTGGCCACAAACATCCGTATGAATGAGATGATCAAGTTTCTGGGTAGCTCTGCGT
ACTTGATTTACTTGAAATGACAATTTTGTCTTCTTTCCCTATTTGCATGTTTCACAAACTTGAGCATTAGAAAGAAAGTCAGATATATTTTCCACTAGCT
CCTTCTGTCTCATCTCTGTGATGCTTCTCATATTGAACTGACCAAACCTTTTGTGCTATAAGTTTGTACATTTGTATGAAGT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.939843
Expected error %
0.576703
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38797.1| Score 161 E Value 5e-39 Identity 24.10% Align. Length 335bp (87.70%) Frame 3
putative polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38786.1| Score 96 E Value 2e-19 Identity 15.20% Align. Length 308bp (80.63%) Frame 3
putative gag-pol polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0162B16
Clone
Clone name
hba-162b16
LE_HBa0162B16
P162B16
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found