Clone Read LE_HBa0162D18_SP6_103474

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0162D18_SP6_103474
Primer
SP6
ID from Seq. Facility
LE_HBa_162_D18-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
9 trimmed for vector and quality, 905 raw
Sequence
>LE_HBa0162D18_SP6_103474 (raw untrimmed)
TTATTGGGTCGTCTTATTCCCATACTTGTGGTGAGTTCGGGGTTTTATTACTGAATTACTTGGTCCACTTGTGCTTTCCGGGGGTGACGTTATGGANACA
CGAGCAGNCGAGACTCTTTAGTGGGATAGCGGCATACGGGTAGGATTAGAAACAAGGGAAAAAAACACGCAGAGCGCCGCAAAACACGGCTTATTAA
ATT
TGGCGGATTCAACTGCATTTAATGATGGGAATTGTTGGTGTTACAATATACTGATGGTGAGTGTACGTACTGTAATGTTATGAAATGCGGGGATGAATCT
TTATTGTTACTAGTCTCTGAAGATTCGTATCCAGATTAAATATCAATTTCCTGCTCTCACCGCGAAAAGATTCGCTACTACGAAGCCCGTGCCCTTGTTT
GTTTCTTTATATGGTCATAATACACACTGCCTGTTCTCCCTCACTCGTTGATACTTTCATGCGGATCTTTGCTGATTTTGATAATTTATTATCTTTTTTG
TTTCATTCATCCATTTACTCTTTATCTTCCTTTTATCCTTAGTGTCGACTTCAACCATTCAAAACCTCCGCGCTCTCTTCTCCTGTTGTTGACTATGTCA
CAGTTCTGCGCTCCGACTCTATGGTAGGTTATTCGCTACGTTACCAGGCTTTTGTATGCAACCGACCCTGTTTCCTTCTTCTCTTCTCCTCTCTCCTCTA
TTTGCATACCTCTTTATCCCTATCACTTCTCTCCTGCTTCCCCCCCGCCATTTTCGGTGACCCATCCGCTAAATCCTCTCTCTTTACCTTCCTCTCATTA
TCTATTGACTACTCTTTCACTCATTATGATTGCGGATCTTCGCTCTGTTCTCTATACATCANTGCTCATATTTATTCTTTACTCAGCTCTGCTATATTAC
TTACC
>LE_HBa0162D18_SP6_103474 (trimmed for quality and cloning vector)
ATTTGGCGG

This is probably not a useful sequence.

Problems:
  • Short cloning insert
  • Low complexity
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
not recorded
Expected error %
0.247998
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0162D18
Clone
Clone name
hba-162d18
LE_HBa0162D18
P162D18
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found