Clone Read LE_HBa0162G22_SP6_103626

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0162G22_SP6_103626
Primer
SP6
ID from Seq. Facility
LE_HBa_162_G22-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
139 trimmed for vector and quality, 876 raw
Sequence
>LE_HBa0162G22_SP6_103626 (raw untrimmed)
GCGTTGACTCAATGGATTTTTACATGATTAAAAAGTTGAACTCTATTATAACTAATGACTCAAATCATAAACTGGCAACTTCCCCTTAATCAACTTTATA
AAGTATTAAGTAAGACCAAAGTCCCCTTGGACGATTTTTTGAATATTTATAAAAAAAATTAATTATATATACAATTATATAAATTTATATATTACTTAAA
ATATAGTAAGATAAACTAATAAATTTAACTATAAACTAAGGATCCGAATTTACAAGTTTCTAAAACCAATTTAAGAAAGCGTTAAGAAAAACTAAAAAAA
ACTGCGACAATTGTCAAAGATTTCGTAAAATAAACTAATTGTATAAAACATATAAACACACACAGACATACACAGGCGTGCACACACACATATATATACG
TAATATACATACATATATATTACTTATACAATTAAGAAAATCAACTTATACAATTTTAAAATGACTAAAAAAAAATTTTTGAATTTGTAAACATTAATCT
ATTGTCAACCTCGTTCGGAATACCAATAAGCTCGTCATATAATTTCCAACTTTGGGGTTCAAAATTGTGGTGTTCACAGGATGGGTATCCTTACCTGGTC
AACTTTCTTCATATTTTTTCTTTGTCCTGTTTTCTTAGCCTGTATCGATAGACATCGTTATTTACTAATCCTCAGGTTTTGATGGTATATAACCAAGTTT
ATTTATGGCATCAACTTACTAGGGCGTCGCTCATGTCTCAAACGGCTCCTATAGGTTCTCCCCATTTCTCATTTTGAGTCCTTAATTCTATAGCTAGAGT
TGTTTTTCTTTGATTCTTAATTATTTTTTCTTCTCTTCTATTTTTTTTCGTTGCTTATTTCGCTTTTTGCTTAACC
>LE_HBa0162G22_SP6_103626 (trimmed for quality and cloning vector)
CTTTATAAAGTATTAAGTAAGACCAAAGTCCCCTTGGACGATTTTTTGAATATTTATAAAAAAAATTAATTATATATACAATTATATAAATTTATATATT
ACTTAAAATATAGTAAGATAAACTAATAAATTTAACTAT

This is probably not a useful sequence.

Problems:
  • Low complexity
  • Short cloning insert
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.764483
Expected error %
1.37447
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0162G22
Clone
Clone name
hba-162g22
LE_HBa0162G22
C01HBa0162G22
P162G22
Clone type
BAC
Contamination
none
Estimated length
129,375
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found