Clone Read LE_HBa0162G22_T7_103627

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0162G22_T7_103627
Primer
T7
ID from Seq. Facility
LE_HBa_162_G22-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
415 trimmed for vector and quality, 878 raw
Genbank Accession
Sequence
>LE_HBa0162G22_T7_103627 (raw untrimmed)
CGTGGACCCGCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGAACTGAGGTAATCGTGCTGCCCTTTCGGGAGAGGTTTGGTGAGAATAT
CAGCCGGTTGTTCCTCTTTAGGTACATACTGCACAGTCATGGTGCCGGCCTGAACTTCATCGCGAACAAAGAGACAATCAGTATCAACATGCTTCATTCT
GGTGTGTAGGACAGAATTCTTGGCCACACAGATGGTTGATTTGTTGTCACAATAGAGAGCAGGAACAGTGTGAGTGGCGTGGAGTTCGCGAAGAATATAT
GTGACCCAATGGTCTCAGCAGCAAGAAGAGCAAGGGCGCGGTATTCAGCTTCAGTCTAGGACCGAGAGACCTTGGGTCGTTTTTTTGTACACCAGGAGAT
CATGTTCTGTTCCTAAATAATGAGAAACCTCTTAGTTGATTTTCAGTCTTTTTTATCATTCTCTCTATTTTGAATATTGAGAATATCCGAAGCTCCATGT
ATTCCGTGTTGAATGATTAAACCACAATGCAGTATTGCCAAACATCTACTTTATAATACATTGTTCACAATTGCCAATCAGTACCACTTTGTCCATTGAT
CTCTCTGACTTTGTCTTGATCAATAACAGGTCTTATTGACTAGTCATGTCAAATTCACTAATTTCTTTATATATCCCTTTATCTTCTCTTCGAACTCTCT
CGCATTTCTTCTATCTTCCTGTTATCCTGTTTTACTGTTTTGCTTTCTTACTTCACCTTTCCCATCTCTATATCTCACTTCCTTTGCTTTCTATCAATGA
TTTCTCTACCTTCTCTTATCTACGCACCACGTATTTTTTAGTCATGGTTTTCTGCCTTTATTGTTATTCTGCAGCTTG
>LE_HBa0162G22_T7_103627 (trimmed for quality and cloning vector)
AGCTTGGAACTGAGGTAATCGTGCTGCCCTTTCGGGAGAGGTTTGGTGAGAATATCAGCCGGTTGTTCCTCTTTAGGTACATACTGCACAGTCATGGTGC
CGGCCTGAACTTCATCGCGAACAAAGAGACAATCAGTATCAACATGCTTCATTCTGGTGTGTAGGACAGAATTCTTGGCCACACAGATGGTTGATTTGTT
GTCACAATAGAGAGCAGGAACAGTGTGAGTGGCGTGGAGTTCGCGAAGAATATATGTGACCCAATGGTCTCAGCAGCAAGAAGAGCAAGGGCGCGGTATT
CAGCTTCAGTCTAGGACCGAGAGACCTTGGGTCGTTTTTTTGTACACCAGGAGATCATGTTCTGTTCCTAAATAATGAGAAACCTCTTAGTTGATTTTCA
GTCTTTTTTATCATT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.970501
Expected error %
2.14232
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU89728.1| Score 98 E Value 3e-21 Identity 51.70% Align. Length 394bp (94.94%) Frame 1
putative retroelement pol polyprotein-like [Solanum tuberosum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAC33963.1| Score 85 E Value 1e-16 Identity 50.60% Align. Length 370bp (89.16%) Frame 1
contains similarity to reverse transcriptases (Pfam; rvt.hmm, score: 11.19) [Arabidopsis thaliana] pir||T01879 hypothetical protein F8M12.17 - Arabidopsis thaliana
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0162G22
Clone
Clone name
hba-162g22
LE_HBa0162G22
C01HBa0162G22
P162G22
Clone type
BAC
Contamination
none
Estimated length
129,375
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found