Clone Read LE_HBa0162J06_T7_103739

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0162J06_T7_103739
Primer
T7
ID from Seq. Facility
LE_HBa_162_J06-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
611 trimmed for vector and quality, 846 raw
Genbank Accession
Sequence
>LE_HBa0162J06_T7_103739 (raw untrimmed)
CTGGTTCCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAATGTATGTCATGAACTGTACACCATCAGACATAGCTTGCGCTATCAATAAA
CTGAGTCGATACCCAAGTAATCCTAATCATAATCATTGGTCGGTAATGAAGAGAGTATTGGGATACTTAGATGACACTCAAAACTATGCTTTACATTACA
ATAGATATCCAGCCGTTCTTGAAGGATATAGTGATGCAAATTGGATTACTGGATCAACTGAAACATAATCCACAAGTGGATACGTTTTTACTATTGGTGG
AGGAGCAATATCTTGGAAATCATCTAAACAAACATGTATAGCTCGCTCTACAATGGAGTGTGAATTCATTGCTTTAGTCAAGGCAGGTGAAGAAGTTGAA
TGGCTCCGGAATTTCTTAGACGATATTCCATTTTGTCCCAAACCAATGGCCCATATATGCATACATTGTGATAGTCAAGATGCAATAGGAACGGCTGGAA
GCAATATGTATAACGGCAAGTCTCGTCACTTAAGACGAAGACATAACTCTGTGAGACAACCACTCTCTAGTGGAATTATCACAATTGACTATGTGAAGTC
AAAAAGATAATGTATCGGATCCACTTACAAAATGCCCAAATATAGAGGGAGTTGAGAAATCTTCCACCGGGAATGGGCACTATGGGTGAATATCAAGTCA
TCGCTGGCGGTAACCCTTACTTCAAATACCGGAATTTCCCAAAACTGCGGTTCAGGGAGTATAACATATGTCATTGTTGACGGATCCCTGCACGTCCAAA
AAAAAAAAATAAAAATTTTATAATAATTTATTTTTTGGGTTCCTTC
>LE_HBa0162J06_T7_103739 (trimmed for quality and cloning vector)
AGCTTAATGTATGTCATGAACTGTACACCATCAGACATAGCTTGCGCTATCAATAAACTGAGTCGATACCCAAGTAATCCTAATCATAATCATTGGTCGG
TAATGAAGAGAGTATTGGGATACTTAGATGACACTCAAAACTATGCTTTACATTACAATAGATATCCAGCCGTTCTTGAAGGATATAGTGATGCAAATTG
GATTACTGGATCAACTGAAACATAATCCACAAGTGGATACGTTTTTACTATTGGTGGAGGAGCAATATCTTGGAAATCATCTAAACAAACATGTATAGCT
CGCTCTACAATGGAGTGTGAATTCATTGCTTTAGTCAAGGCAGGTGAAGAAGTTGAATGGCTCCGGAATTTCTTAGACGATATTCCATTTTGTCCCAAAC
CAATGGCCCATATATGCATACATTGTGATAGTCAAGATGCAATAGGAACGGCTGGAAGCAATATGTATAACGGCAAGTCTCGTCACTTAAGACGAAGACA
TAACTCTGTGAGACAACCACTCTCTAGTGGAATTATCACAATTGACTATGTGAAGTCAAAAAGATAATGTATCGGATCCACTTACAAAATGCCCAAATAT
AGAGGGAGTTG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.970373
Expected error %
1.18617
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g23160.1 Score 82 E Value 3e-16 Identity 10.10% Align. Length 512bp (83.80%) Frame 2
68417.m03342 protein kinase family protein contains Pfam domain PF00069: Protein kinase domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38766.1| Score 280 E Value 1e-74 Identity 23.80% Align. Length 557bp (91.16%) Frame 2
putative polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU89783.1| Score 241 E Value 2e-64 Identity 68.40% Align. Length 609bp (99.67%) Frame 2
putative retrovirus-related pol polyprotein-like [Solanum tuberosum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0162J06
Clone
Clone name
hba-162j6
LE_HBa0162J06
P162J06
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found