Clone Read LE_HBa0162L03_T7_103829

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0162L03_T7_103829
Primer
T7
ID from Seq. Facility
LE_HBa_162_L03-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
606 trimmed for vector and quality, 809 raw
Genbank Accession
Sequence
>LE_HBa0162L03_T7_103829 (raw untrimmed)
CGCGGTACCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGATAGATCAGAAGTAACGTGCCTTTTGGCCCTAGTATCCAACAGCCATTCA
GAGGAAGGGCCGATTTGAGATGCATAATTGGCACGGTTATCACTATTTCGGCTCTCCTCATACCAAAACCAGCAACGAACAACGGTGTGTCCTGTTTTCT
GACAGATTTGACAAGTTGGACGATCCCGCTCGTAAGTGCCCTGCCCGCCGCTGGAAGATGACTGCCCGCTGCTGCCGAAGGAGTGCAGGCTGTTGTTGCT
GCCGTGCTGCTGACCGTCGTATGGCAGACGACTGCCCTGCCGACCGCCGCGCCCGTGGCCTCCGCTATTTCTGCCGTAGCCGCCGCGGCTCCCTTGCCGG
CCACCACCACGCCCCCCGCGATAGTTCTGGCTTGCGGTGAGGGCGGTGGCCGACTCCATAACAGCGGCTTCTCGGAGAAGAAGTTTGCTCTCCAGATCCA
CGTTGATTTCTTCACTTTTTAGCCACAAGGAGAGAGTAGCCAGGTTCAACGGGTGTTGGACTGATGCGAACCGCCTGTTTAACGGAGGAGTAAGCTGACG
GGAGCCCCAGAACGACGCACATGACAAGTATCTTTTTCGGGAATGATTTCTTTCACGGTGTCCCAGGGCTGATATGATTGTGATCATACTATTTTATTCT
CTCTCGCCTCTTCATCACATCTTCTCTGCTAGACTGACTATTACACTTCTCACCACCCTACCTCTTTTCTTCTCCACCTTGTCCTTGTCTTCTCATTTTA
TGCTGTCCC
>LE_HBa0162L03_T7_103829 (trimmed for quality and cloning vector)
AGCTTGGATAGATCAGAAGTAACGTGCCTTTTGGCCCTAGTATCCAACAGCCATTCAGAGGAAGGGCCGATTTGAGATGCATAATTGGCACGGTTATCAC
TATTTCGGCTCTCCTCATACCAAAACCAGCAACGAACAACGGTGTGTCCTGTTTTCTGACAGATTTGACAAGTTGGACGATCCCGCTCGTAAGTGCCCTG
CCCGCCGCTGGAAGATGACTGCCCGCTGCTGCCGAAGGAGTGCAGGCTGTTGTTGCTGCCGTGCTGCTGACCGTCGTATGGCAGACGACTGCCCTGCCGA
CCGCCGCGCCCGTGGCCTCCGCTATTTCTGCCGTAGCCGCCGCGGCTCCCTTGCCGGCCACCACCACGCCCCCCGCGATAGTTCTGGCTTGCGGTGAGGG
CGGTGGCCGACTCCATAACAGCGGCTTCTCGGAGAAGAAGTTTGCTCTCCAGATCCACGTTGATTTCTTCACTTTTTAGCCACAAGGAGAGAGTAGCCAG
GTTCAACGGGTGTTGGACTGATGCGAACCGCCTGTTTAACGGAGGAGTAAGCTGACGGGAGCCCCAGAACGACGCACATGACAAGTATCTTTTTCGGGAA
TGATTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.9842
Expected error %
0.924305
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0162L03
Clone
Clone name
hba-162l3
LE_HBa0162L03
C02HBa0162L03
P162L03
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found