Clone Read LE_HBa0162M24_SP6_103918

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0162M24_SP6_103918
Primer
SP6
ID from Seq. Facility
LE_HBa_162_M24-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
630 trimmed for vector and quality, 818 raw
Genbank Accession
Sequence
>LE_HBa0162M24_SP6_103918 (raw untrimmed)
TTAATATTTCTGCTTCCCAGGTAGGAATTACTCCAACGGATTGAGAAAATGTCAAATTTAACCAAGTTGTGATTGTTTTTCTTTGCCCATTAACTATTAA
ATGGTTCTTTAACAGTGGCGGATTCAGAACTTTTCAACTATGGGTGCTCACCATTTTCAACTTATATCAACCAAAGAGCGTAACTGCGAGTTAAAATTCG
TCAAAATAGGTGTTATTTTTTCAATGTAATAGACAATCGAAATATTTGAATTGGTTCAAAAAAAAAAGGAGGAGAAACAATATACTTTCACATACAATTG
TAGTTACCAAAAAGACAAACCAACGGAAGGAAGACTCTTTCGCTTTTAAATTGAAAAACTGAAATAAAGGCGCTAGAACACATTTTTTTCCTTTCCTTTT
ATTTTTTCTAATTAGACTGATGAGAAGAAAAAGTTAATAGTAATGGAAAATCATGACTGTTTATATTTTTTTGGAGATTAAGTTACATAATAAACATGAG
AAGCAAACGATTCAAGATTTTAAGATCGAGGTTACTTTTGAAGCTATCTATCATAAATATAAATGTATAAATCTTATACTTGTCAAAAGAAAAAATAATT
ATATTTATATAAAATAGCCAAAAAAAATCAAAAAAGAAAAATAATCTTCAAAAAAATAATTTTGTTTTAGAAAAATTAGAAATACGACAATTCCTGAAAG
GGGGAAAAAGAAAAAGGAAAAAAAAAAGAGTTGAATTTAAAAATAAAAAAAATGTAACTACCGGGAAATTGGAACTTTGGGCCTTTTCCTTAACCAAAAA
AAAACCCCTTGAGAAACN
>LE_HBa0162M24_SP6_103918 (trimmed for quality and cloning vector)
AACGGATTGAGAAAATGTCAAATTTAACCAAGTTGTGATTGTTTTTCTTTGCCCATTAACTATTAAATGGTTCTTTAACAGTGGCGGATTCAGAACTTTT
CAACTATGGGTGCTCACCATTTTCAACTTATATCAACCAAAGAGCGTAACTGCGAGTTAAAATTCGTCAAAATAGGTGTTATTTTTTCAATGTAATAGAC
AATCGAAATATTTGAATTGGTTCAAAAAAAAAAGGAGGAGAAACAATATACTTTCACATACAATTGTAGTTACCAAAAAGACAAACCAACGGAAGGAAGA
CTCTTTCGCTTTTAAATTGAAAAACTGAAATAAAGGCGCTAGAACACATTTTTTTCCTTTCCTTTTATTTTTTCTAATTAGACTGATGAGAAGAAAAAGT
TAATAGTAATGGAAAATCATGACTGTTTATATTTTTTTGGAGATTAAGTTACATAATAAACATGAGAAGCAAACGATTCAAGATTTTAAGATCGAGGTTA
CTTTTGAAGCTATCTATCATAAATATAAATGTATAAATCTTATACTTGTCAAAAGAAAAAATAATTATATTTATATAAAATAGCCAAAAAAAATCAAAAA
AGAAAAATAATCTTCAAAAAAATAATTTTG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.904548
Expected error %
0.273885
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0162M24
Clone
Clone name
hba-162m24
LE_HBa0162M24
C08HBa0162M24
P162M24
Clone type
BAC
Contamination
none
Estimated length
72,189
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found