Clone Read LE_HBa0162M24_T7_103919

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0162M24_T7_103919
Primer
T7
ID from Seq. Facility
LE_HBa_162_M24-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
2 trimmed for vector and quality, 1293 raw
Sequence
>LE_HBa0162M24_T7_103919 (raw untrimmed)
GACGCACAGGAACGCAGGACGAACGCCAGGAAGGAAGGGAGAGGGGATGTCGGGAAGGAAGAGGGCAGCGGTGGGGCAGAGAGAGGGGGCGAGAACGGAG
AGTAAGCTAACCAGGCTTCCCCCCATATGAAGGAGAGGCCACAGCANCGGTGACGCAACCGAGAAGAGATCACAGAAAACCCCTTTTAGGGGGGGAGATA
AGATACTGATGAGTGGAAGGAGCAAAACACAGACATCAAACTCCCTCACTCGACTCACGGAGAAGGCGAGCGGATGTTCATGAGAAGGCAAAATAAGAAA
ACGAGCNAACCACACAGGAGACCAACAAAAACACAAGAGGATAACACGACAGGGAGAGATAAAATTCAAACGATTGCAAGTATCACGATGACAAGGCAAA
AAGCGAGCATATCACACAGGCACGAGTACACAAACAAAACGCAGAAAGAAAAACAAGAATGCAGAACGAGCAGGGGCAGAATGCACTATGAGAGCGCACA
GCGCATGCTGCAGCTAAGGAACACCACACACATACATAGCAAGCCACCGGACGAAGGACACCACACACAGAACCGAGAACACGATAAAACNAAAAGGAAG
ATCAAGGCGCACGAAACGCCGGACACACGCAGAACAGAACTGACCGGAACAGCAGCCACGGAAGAGCGCAGGGAAAGGTCGGAGGACAAACGGCGGCGAG
CAGGAGGCAACAATATGGACCCATATTTCGACGTCACACACCCCCAAAAGCACGCACACCGATACGAAAGAAGGGCTCAAAATAAGAAAAAAAGAAGAGA
CGAAGAGGGNGCCACGACGGACCCTAACGACTCAACAATCACATGCCCCCTGCTCGTCCCGCGCACCACACCACACCGCAAACACAATAGCAAAACAGAC
ACGCACACAAATATGAACGACTACAATGAGGATACGGCACGAGAGTGGTCCACCCTGAATGAAGTAGAGGAGATGCACGTGGATACTGGAGAGGCGCGAG
TGTATCACTGG
GGGCGTGCGCACATCGCACTGACCTGCAAAGGAACAAGCAGGGCTACTTACGACGACCCCGCGCCAACCACAACACAGGGACACTCTAT
ACCACGCGCACGGACAAGACAGCATCCACGACAGGTGAGCAGCCAACACGCATACACAAACACACTGCGACGCTGACCACGACCATCCACACACGCAAAT
ACTGTATCACGAACACAACACNACCAGCCACAGCGTGCAACACACGTAAAAGCATAATACGAACATAAATATTAGAGACGGACTAACGCAAGN
>LE_HBa0162M24_T7_103919 (trimmed for quality and cloning vector)
GG

This is probably not a useful sequence.

Problems:
  • Low complexity
  • High predicted error rate
  • Short cloning insert
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
not recorded
Expected error %
8.32163
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0162M24
Clone
Clone name
hba-162m24
LE_HBa0162M24
C08HBa0162M24
P162M24
Clone type
BAC
Contamination
none
Estimated length
72,189
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found