Clone Read LE_HBa0162P08_T7_104031

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0162P08_T7_104031
Primer
T7
ID from Seq. Facility
LE_HBa_162_P08-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
622 trimmed for vector and quality, 819 raw
Genbank Accession
Sequence
>LE_HBa0162P08_T7_104031 (raw untrimmed)
CGTGGGACCCGGGGGTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAAGAAATTTAATATTGTTGGTACCTTTTGTGGTAAGAAAATTACTTTTATTT
TTTGTGTTCTTTTTTTTAGGGGAATAAAAAGAAAAAAGAGAATTATTTTATCATATGATAAAATAGATTTTGGAGGAATTATTACTACTTTGATATATTC
AAGTATATTTTTTGAATGAGTAAGATTATTTTTATTTTCTTCCCATGGGTATTCAAGTATTTGCACTCCTTCATTTTTCTTTTCATTGAGAAAAGTCATT
TTGTACATAAAGCTAAGATGTGCACTTTAATTATTTTTTCTATATTCTTGATTTTATAAAACTATGAGAAGAAGTAAATGAATCGATATTGTATCCGAAC
AATATTTGAACATGAATTTAGTTTCTCGTTGAAATTCAATTTCTTCTAAGAAAAATTGAAATATGATGGAAACTGGGAAAGAAAGAAAAACTTAGCAAGA
AAAGTGACTTGCATGAAATCATTACCGATAAATGGAGTATGATTCTATGGGAGTAAAACCAGGTTCTATCTTTATTTTTCCTAGATTAGTTTTTCTATCT
CTTATAAGTTATGAGATTAAATTTCATATATGTTAGGATATATGGTCATTCTGTGATGGATTTCAAAATTATTATGTTCGTATTAATTGGCTCTTTCATG
ATAATTTCTATCCTAAACCTTTCACTTACCTAATATGCCTTCCGCTTACGAAATCTTTTTCTTTTGGGTGGTATTTTTCCTCTTTGTTAACTTCTTTTCT
GGCTTTACTCTTGACACCT
>LE_HBa0162P08_T7_104031 (trimmed for quality and cloning vector)
AGCTTAAGAAATTTAATATTGTTGGTACCTTTTGTGGTAAGAAAATTACTTTTATTTTTTGTGTTCTTTTTTTTAGGGGAATAAAAAGAAAAAAGAGAAT
TATTTTATCATATGATAAAATAGATTTTGGAGGAATTATTACTACTTTGATATATTCAAGTATATTTTTTGAATGAGTAAGATTATTTTTATTTTCTTCC
CATGGGTATTCAAGTATTTGCACTCCTTCATTTTTCTTTTCATTGAGAAAAGTCATTTTGTACATAAAGCTAAGATGTGCACTTTAATTATTTTTTCTAT
ATTCTTGATTTTATAAAACTATGAGAAGAAGTAAATGAATCGATATTGTATCCGAACAATATTTGAACATGAATTTAGTTTCTCGTTGAAATTCAATTTC
TTCTAAGAAAAATTGAAATATGATGGAAACTGGGAAAGAAAGAAAAACTTAGCAAGAAAAGTGACTTGCATGAAATCATTACCGATAAATGGAGTATGAT
TCTATGGGAGTAAAACCAGGTTCTATCTTTATTTTTCCTAGATTAGTTTTTCTATCTCTTATAAGTTATGAGATTAAATTTCATATATGTTAGGATATAT
GGTCATTCTGTGATGGATTTCA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.891826
Expected error %
1.07724
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0162P08
Clone
Clone name
hba-162p8
LE_HBa0162P08
P162P08
Clone type
BAC
Contamination
none
Estimated length
131,433
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found