Clone Read LE_HBa0172C07_SP6_104172

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0172C07_SP6_104172
Primer
SP6
ID from Seq. Facility
LE_HBa_172_C07-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
549 trimmed for vector and quality, 963 raw
Genbank Accession
Sequence
>LE_HBa0172C07_SP6_104172 (raw untrimmed)
GCGGGGTTTTATTGCAAGTTCTCTAAGTGTGAGTTTTGGCTAGATGCAGTGTCCTTCTTGGGGCACGTGGTTTCTAAGGATGGAGTGATGGTAGATCCTT
CTAAGATTGAGACAGTGAAGAATTGGGTAAGACCTACTAATGTGTCAGAAATAAGGAGTTTTGTTGGGTTAGCTAGCTACTACCGCCGATTTGTCAAGGG
ATTCTCTTCCATTGCTTCCCAATTGACGAACTTTACTAAGCAGAATGTTCCATTTGTATGGTCGGACGAGTGTGAAGAAAGCTTTCAGAAGCTCAAGACT
TTGTTGACTACCGCACCCATTCTCACCTTGCCCGTAGAGGGGGAGAACTTCATTGTTTATTGTGATTCATCCTATTCTAGTTTGGGTGCAGTACTAATGC
AAGAGAAGAATGTGATTGCTTATGCTTCGAGGCAATTAAAAGTGCATGAACGTAACTATCCAACTCATGATTTGGAATTGGCTGTGGTAGTGTGTGCATT
AAAGCAATGGAGACACTATTTATATGGGGTTAAGTGTGAGGTCTACATGGATCATCGTAGCCTTCACTATGTCTTTTCCTCAGAAAGATTTTGAACTTGA
GACAGAAGAGATGGATGGAGCTACTAAAGGACTACTATATTCCTATCTTGTATCTCCCGGAAAGGCTAATGTTGTGGCCTATTCCTCTAGACATATGGCC
GCGAACATTGGAAATCTAGTCTCCTCTGCCATTTTTTAACTTTCATCTGCTAGCTAGGTACTGACCTTACTTATTAATTTATTCATTTAGTAATTAACTA
CACGTATCATTCTCGCTTCCTTACCTCTCTCCTTGTCTTTTCTGGCACCTCTTCCGCGATTTGTCTCACCTATAACACCCACTCAAACACACCTCCCTTC
CCCCCTCAACCACCCCTCAATACACTCTCCACCAATAACTCACTATTGTCTGTAATTTTATTC
>LE_HBa0172C07_SP6_104172 (trimmed for quality and cloning vector)
TGTGAGTTTTGGCTAGATGCAGTGTCCTTCTTGGGGCACGTGGTTTCTAAGGATGGAGTGATGGTAGATCCTTCTAAGATTGAGACAGTGAAGAATTGGG
TAAGACCTACTAATGTGTCAGAAATAAGGAGTTTTGTTGGGTTAGCTAGCTACTACCGCCGATTTGTCAAGGGATTCTCTTCCATTGCTTCCCAATTGAC
GAACTTTACTAAGCAGAATGTTCCATTTGTATGGTCGGACGAGTGTGAAGAAAGCTTTCAGAAGCTCAAGACTTTGTTGACTACCGCACCCATTCTCACC
TTGCCCGTAGAGGGGGAGAACTTCATTGTTTATTGTGATTCATCCTATTCTAGTTTGGGTGCAGTACTAATGCAAGAGAAGAATGTGATTGCTTATGCTT
CGAGGCAATTAAAAGTGCATGAACGTAACTATCCAACTCATGATTTGGAATTGGCTGTGGTAGTGTGTGCATTAAAGCAATGGAGACACTATTTATATGG
GGTTAAGTGTGAGGTCTACATGGATCATCGTAGCCTTCACTATGTCTTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.975406
Expected error %
0.257486
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38745.1| Score 261 E Value 9e-69 Identity 22.00% Align. Length 545bp (99.27%) Frame 2
putative polyprotein, 3'-partial [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT66771.1| Score 260 E Value 2e-68 Identity 22.20% Align. Length 545bp (99.27%) Frame 2
putative polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0172C07
Clone
Clone name
hba-172c7
LE_HBa0172C07
P172C07
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found