Clone Read LE_HBa0172C07_T7_104173

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0172C07_T7_104173
Primer
T7
ID from Seq. Facility
LE_HBa_172_C07-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
766 trimmed for vector and quality, 969 raw
Genbank Accession
Sequence
>LE_HBa0172C07_T7_104173 (raw untrimmed)
CAAACTGGGTCTCCGGGGGTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCGAATACTGTTAGAACAGTACTTATAACTACAATTGGTAAATAAAAAC
TCGACCAACAAATAAATCTATTTAAAATTGACATTTAAATTAGTAAATACTAAAACCCATAAGCTAATTAGAGCATTTGATCACATAACCACTTCCCCAA
AGGATGGGGTTTTTTATCCACACATCATAAAAAGCAAGAAAATATTACCAATGATGTTCTCCATCAGCTGGGTAAGAAATGTCAAGTCTTCAAGGCTTGG
AATCAGTTTAGAATAAAAACCCTACTCAATATTCTTCTCAAAAACTACTAAAAGTTGTGTTTAGATTAAAAACTCAGAATTAGAATGAGTGGGAACTTTT
AGAACCAGAAAAACTCCTCCGCATCTTATAAAAAACGCATTAATACTCTTCCAGATTTTCAGCTTCAGGATAGATTGACAGTATAAGTCGATCATCGCCG
ACCAATTCGATGATGTACCAAATGTCCTCTTCCATAACCTTCATGAATTAAATCTTTATTATTCACAAACTGTAACTTTAGGTGATCAGTATCTCCATCG
CCGATTCATTCTCTGGTTAGCCAAGTTGGCTTCTTCTCAGGGTTAGTCCTTTTGGAACTTTTGGGGAGTTAAAGGACCACTCCTCTGTTCACCAAGTGGA
CTTGGCAATCAAAACTTTGCTTTTTCTCAACTTTTCAATCTAATAGCTCCTTTTTTTCATGAAAATGTCTTTTCTTGATCTTTTGCTTTTATTGCTGAAA
ATAACATTTTAAACATCCTTTGGAAGGCATCCGTATACCAGAAAATGAATAATAAACTCTAAATAAGTGAAAATCCCCACTTGCATCAGAACTAATTAAA
TTTTTGTTATCCTTAAAAAAACTAAGATAAATAGTTAATTAAGAATCCAACAAAGTTGCCCAAACATTA
>LE_HBa0172C07_T7_104173 (trimmed for quality and cloning vector)
AGCTTCGAATACTGTTAGAACAGTACTTATAACTACAATTGGTAAATAAAAACTCGACCAACAAATAAATCTATTTAAAATTGACATTTAAATTAGTAAA
TACTAAAACCCATAAGCTAATTAGAGCATTTGATCACATAACCACTTCCCCAAAGGATGGGGTTTTTTATCCACACATCATAAAAAGCAAGAAAATATTA
CCAATGATGTTCTCCATCAGCTGGGTAAGAAATGTCAAGTCTTCAAGGCTTGGAATCAGTTTAGAATAAAAACCCTACTCAATATTCTTCTCAAAAACTA
CTAAAAGTTGTGTTTAGATTAAAAACTCAGAATTAGAATGAGTGGGAACTTTTAGAACCAGAAAAACTCCTCCGCATCTTATAAAAAACGCATTAATACT
CTTCCAGATTTTCAGCTTCAGGATAGATTGACAGTATAAGTCGATCATCGCCGACCAATTCGATGATGTACCAAATGTCCTCTTCCATAACCTTCATGAA
TTAAATCTTTATTATTCACAAACTGTAACTTTAGGTGATCAGTATCTCCATCGCCGATTCATTCTCTGGTTAGCCAAGTTGGCTTCTTCTCAGGGTTAGT
CCTTTTGGAACTTTTGGGGAGTTAAAGGACCACTCCTCTGTTCACCAAGTGGACTTGGCAATCAAAACTTTGCTTTTTCTCAACTTTTCAATCTAATAGC
TCCTTTTTTTCATGAAAATGTCTTTTCTTGATCTTTTGCTTTTATTGCTGAAAATAACATTTTAAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.9394
Expected error %
1.81554
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0172C07
Clone
Clone name
hba-172c7
LE_HBa0172C07
P172C07
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found