Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Clone Read LE_HBa0172E03_SP6_104260

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0172E03_SP6_104260
Primer
SP6
ID from Seq. Facility
LE_HBa_172_E03-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
435 trimmed for vector and quality, 962 raw
Genbank Accession
Sequence
>LE_HBa0172E03_SP6_104260 (raw untrimmed)
CCCGGGGTTATCCCTACCGGTTTGCCTGAGTGTTGGTCTAGCCCTCTGTTAAATGGGAAAAGGGAAAGCATCTCCCCTTCTGTCTCTTTGTTGGGTAAAA
CAGACAACTAATTTATCCTTTCAAGGTACATGAAAAAACAAAAGGAACTTATGCCAGTCAAGCAAGCTATAATGTTTCTGTATAAGAACCTATTGCATCC
GGGAGCAGGTGGCGGGTGCAGAAATGTTATGCTGTAATCTTAGTAGGACTGGTGAAACCTTAGTCAATCTGTAGTCAAGTGACAGTTTTTCACCTCTGAA
TAATTCACTCTTATTCACTTTGGCTGATTTTTTTTCCACCTTATATATGATGAATATTCTTCATGTTTTGTAGTCAGCACTATCACTCAAAATTTAGGCT
TTTCAAAGTGGACAGAATGGAATAATGTCCCTCTGATGTTGGCAATTACCCAAGCAAGCACCTCTTATTTTTAGTTAACATGGACATACACCACAGCAGT
TAATTGCTTCTTGGGCACCCCAACCGTACCTCATAAATACTTACAACTGACTAGTTTCGATACTAAACTCCTCTTTATCATCCTTTCATGCGCCAGTATT
TCCTGTTACAAGGAGGGGATGGCAATTCTGTTAGCAATCCAAATTGTTGGGCAATGAATGCTAGGATGCCCCCCATCATTCGTTATACTCCTGTTCTCCC
ACTCAATTCAAAATGGAGTTAAAGTGGTAAACAATATACCTAGATAGCGGATTTTTAGCACACTGGTAAATCTGGTCAACCCACATCCCACCCAGTCTCA
CCCGTTTACCCTCCCTGAGTACGAACTTCCGCCCTTTTCCTCTATTAATCCTTCTTGTCAGTTAATCCATCATACATACGTTTAGGATCTACCGTTACTT
GAGCTTCTCTAACTCTATTCCTCCTCTCCGTCTACCCGTCTCCGCCANCCCGTGTCGTCTCT
>LE_HBa0172E03_SP6_104260 (trimmed for quality and cloning vector)
AGCCCTCTGTTAAATGGGAAAAGGGAAAGCATCTCCCCTTCTGTCTCTTTGTTGGGTAAAACAGACAACTAATTTATCCTTTCAAGGTACATGAAAAAAC
AAAAGGAACTTATGCCAGTCAAGCAAGCTATAATGTTTCTGTATAAGAACCTATTGCATCCGGGAGCAGGTGGCGGGTGCAGAAATGTTATGCTGTAATC
TTAGTAGGACTGGTGAAACCTTAGTCAATCTGTAGTCAAGTGACAGTTTTTCACCTCTGAATAATTCACTCTTATTCACTTTGGCTGATTTTTTTTCCAC
CTTATATATGATGAATATTCTTCATGTTTTGTAGTCAGCACTATCACTCAAAATTTAGGCTTTTCAAAGTGGACAGAATGGAATAATGTCCCTCTGATGT
TGGCAATTACCCAAGCAAGCACCTCTTATTTTTAG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.955927
Expected error %
1.32232
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0172E03
Clone
Clone name
hba-172e3
LE_HBa0172E03
P172E03
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found