Clone Read LE_HBa0172H10_SP6_104418

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0172H10_SP6_104418
Primer
SP6
ID from Seq. Facility
LE_HBa_172_H10-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
438 trimmed for vector and quality, 1030 raw
Genbank Accession
Sequence
>LE_HBa0172H10_SP6_104418 (raw untrimmed)
GCATTTATTTGGAACTTCACTTGGGAAGGGACTGCTATCAAAGAGCTACCCGAGTCCATCATAAATCTCCGGTGGGATTGTTTCCATAAACCTCAGGAAT
TGCAAGGATCTGGAATGTGTAATTTATAGCATTTGTGGTTTGAGATGTCTCAGGACTCTAAATCTCTCTGGCTGTTCAAAACTTGAGGCATTGCCAGAAA
CCCTTGGACAATTGGAAACATTAGAAGAGCTACTTGTAGATGGAACTGCAATCAGCAAGCTACCATCAACAGTCTCGGAGATGGAAAATTTGAAAATCCT
TTCTTTCAGTGGATGCAAGAAAAAGAAAAAGGATAAGGCATTCTGGAAAAACAGTTTTAGCTTTCGCTTGAATCTAAAGTTAACTTCACTGCCAAATGTC
AGGCGCATCACGAGACGATCAAATACTGGAAGAAAAAAGAAGACAGAAGTATCAGGACCATCATTATCTGGTTTGCTTGCCTTAAAGAAACTAGATCTTA
TTGACTCTGATTTGGTAAATGAAATCTCTGGCGATTTTTGGCACCTCTCCTTCTTGGAACATTTAAATTCCGCTCCTAAACTATTTTTCCGAACTTACTC
TCCGCATTTATGTGCTTCCATCAAATCCCCCGGTCCTTCTTGTCTTCTAAACTCTAAAACTTTGTTTTCTTGCCTTCTCTTCCCTGGCGTTTTGATGTTT
TATGAGTCTATTCGCGGCCTTTTGCGTCTCTACTCTTTTCGATCTCGCATTTCGCCTTAGGACTTCTTTTAAAATCTGACTCTGATTCCTCCTTTTCTTA
TAAACTCCTCCTCCTACCGTTTTTCGTTAGTTCTTTTTCTTTTTTTTTTCTTCTTTTTTTTTTTGTTTTCTTTTTTCTCTCTTTTTCGTTTTCCCTTCTC
TTTTCTTCTGTAGTTCCTGCTTTGTTCTTCTCTTCTGCCTTTTTTGATTGATTACATCTTCTTTTTTTTTTTATTCACTTCTTTATTATTTCTTTTTTCC
TTTTTTCTTGTTCTCTCTCTTTTCCACATA
>LE_HBa0172H10_SP6_104418 (trimmed for quality and cloning vector)
CAAAGAGCTACCCGAGTCCATCATAAATCTCCGGTGGGATTGTTTCCATAAACCTCAGGAATTGCAAGGATCTGGAATGTGTAATTTATAGCATTTGTGG
TTTGAGATGTCTCAGGACTCTAAATCTCTCTGGCTGTTCAAAACTTGAGGCATTGCCAGAAACCCTTGGACAATTGGAAACATTAGAAGAGCTACTTGTA
GATGGAACTGCAATCAGCAAGCTACCATCAACAGTCTCGGAGATGGAAAATTTGAAAATCCTTTCTTTCAGTGGATGCAAGAAAAAGAAAAAGGATAAGG
CATTCTGGAAAAACAGTTTTAGCTTTCGCTTGAATCTAAAGTTAACTTCACTGCCAAATGTCAGGCGCATCACGAGACGATCAAATACTGGAAGAAAAAA
GAAGACAGAAGTATCAGGACCATCATTATCTGGTTTGC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.962199
Expected error %
0.437267
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0172H10
Clone
Clone name
hba-172h10
LE_HBa0172H10
C02HBa0172H10
P172H10
Clone type
BAC
Contamination
none
Estimated length
122,657
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found