Clone Read LE_HBa0173C14_SP6_104954

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0173C14_SP6_104954
Primer
SP6
ID from Seq. Facility
LE_HBa_173_C14-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
455 trimmed for vector and quality, 908 raw
Sequence
>LE_HBa0173C14_SP6_104954 (raw untrimmed)
GTACCCGGGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTTTGAGAATATATTTCAGGAGTCCATTAAGAGGTTGGCTACTACCCCGGTGTTGA
CCATACCAGACTGTACTGAAGATTTTGTAGTGCACTGTGATTTATATAGAGTCGGTTTGGATTGCGTGTTAATGCAAAATGACAAGGATATAAGGTTCAT
GAGAAGACTTATCAAACCCATTACTTAGAGTTGGTTGTTGTAGTTTTCTCCTTGAATATATGGTGTCACTATTTGTATGGTGTTAATGTCGACATATTCA
CTTATCATAAGATCCTATTATATGTGTTTACCTAGAAAGAGCTATATCTCAAACATAGGAGGTACTTAGAGTTACTCAAGAATTATGACATGAGTATTCT
TTACCACCTAGTTAGGATAATGTGGTTGTTGATGTTTTATGCAAGTTCGATATGCGATGTACCCCCCATGTAAAGCTAATGTGGTTCCTGATGTTTGCAA
CATTGTTATGAAATAGGAATTATCGCCTTTGTTTATGAATAAAAAAGGGAGTTTTACTAACAATTACATATTCTTTCCTTGGTGTTAGTCACACTTTTTT
GATTCCTCTGTAAGTAGGGTAGTGGAGACAAATGGGACTTGAGTTTACTCTTTTCTGTGTCCCAAGCGTTGAAAGAATAAAATATTTATATTTTCATTTT
TTCTTTTGCAAAGTATTTTTTGGATTTTATTAAATATTACGTATAATTTTGTTTGTTAATTATTATTCTGAGTTATATTCTTTTTTTTTTTATCCTGTAT
TAGTTTGGTCTTTCGATTATTTTGTTTATTTTTGCCTCTGCTTCTCTCTTTTTTTTGCTGTGAATATTCTACCTTCTCTTTTTTAGTCCTCCTTCTCTCC
CCTTTCCT
>LE_HBa0173C14_SP6_104954 (trimmed for quality and cloning vector)
AGCTTTTTGAGAATATATTTCAGGAGTCCATTAAGAGGTTGGCTACTACCCCGGTGTTGACCATACCAGACTGTACTGAAGATTTTGTAGTGCACTGTGA
TTTATATAGAGTCGGTTTGGATTGCGTGTTAATGCAAAATGACAAGGATATAAGGTTCATGAGAAGACTTATCAAACCCATTACTTAGAGTTGGTTGTTG
TAGTTTTCTCCTTGAATATATGGTGTCACTATTTGTATGGTGTTAATGTCGACATATTCACTTATCATAAGATCCTATTATATGTGTTTACCTAGAAAGA
GCTATATCTCAAACATAGGAGGTACTTAGAGTTACTCAAGAATTATGACATGAGTATTCTTTACCACCTAGTTAGGATAATGTGGTTGTTGATGTTTTAT
GCAAGTTCGATATGCGATGTACCCCCCATGTAAAGCTAATGTGGTTCCTGATGTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.950519
Expected error %
0.967507
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38744.1| Score 107 E Value 1e-35 Identity 72.20% Align. Length 358bp (78.68%) Frame 1
putative gag-pol polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAV31171.1| Score 107 E Value 7e-31 Identity 72.20% Align. Length 358bp (78.68%) Frame 1
putative polyprotein [Solanum tuberosum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0173C14
Clone
Clone name
hba-173c14
LE_HBa0173C14
P173C14
Clone type
BAC
Contamination
none
Estimated length
105,549
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found