Clone Read LE_HBa0173C14_T7_104955

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0173C14_T7_104955
Primer
T7
ID from Seq. Facility
LE_HBa_173_C14-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
398 trimmed for vector and quality, 860 raw
Sequence
>LE_HBa0173C14_T7_104955 (raw untrimmed)
CTCCGCTCCCGGGGCGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTTTGAGAATATATTTCAGGACCCTTAAGAAGAGGTTGGCTACTACCCCGGT
GTTGACCATACCACAAGGTACTGAAGATTTTGTAGTGCACTGTGATTTATATAGAGTCGGTTTGGATTGCGTGTTAATGCAAAATGACAAGGATATAAGG
TTCATGAGAAGACTTATCAAACCCATTACTTAGAGTTGGTTGTTGTAGTTTTCTCCTTGAATATATGGTGTCACTATTTGTATGGTGTTAATGTCGACAT
ATTCACTTATCATAAGATCCTATTATATGTGTTTACCTAGAAAGAGCTATATCTCAAACATAGGAGGTACTTATAGTTACTCAAGAATTATGACATGAGT
ATTCTTTACCACCTAGTTAGGATAATGTGGTTGTTGATGTTTTATGAAATCATAATATCTTATTATCCTGCTATTGTCAGTTAGTGTGGATTTTCTTTTC
CGCCCCCCAATTTTTTAATTATGNAAAAATTTATTATGTTTGGTTAGTATTATGGGTTTTTATTTATTTTTTATTTTTTTTTTTTTTTTTTTTTTTTATA
TTTTTATATTATTTTATAAATTGTGTAGATGTAATTTGTGAATTTTTTTTTTTGATTTTTTTATAATATTTTATTTTTATATTAGGTGGATTGAAATATG
TTTTGTGTTATTTTATTATTTATGTAATTTTTAGGTTTTTTTAATTATTGATTTTTATTATTTTTATTTATTTTTTAATTGTTTAAATTATAATTTTTTA
AAGTNATATTTTAGTTTATTTATAAAAAATGTAATTAGTATAGAAAATAAAATATATTTT
>LE_HBa0173C14_T7_104955 (trimmed for quality and cloning vector)
GCATGCAAGCTTTTTGAGAATATATTTCAGGACCCTTAAGAAGAGGTTGGCTACTACCCCGGTGTTGACCATACCACAAGGTACTGAAGATTTTGTAGTG
CACTGTGATTTATATAGAGTCGGTTTGGATTGCGTGTTAATGCAAAATGACAAGGATATAAGGTTCATGAGAAGACTTATCAAACCCATTACTTAGAGTT
GGTTGTTGTAGTTTTCTCCTTGAATATATGGTGTCACTATTTGTATGGTGTTAATGTCGACATATTCACTTATCATAAGATCCTATTATATGTGTTTACC
TAGAAAGAGCTATATCTCAAACATAGGAGGTACTTATAGTTACTCAAGAATTATGACATGAGTATTCTTTACCACCTAGTTAGGATAATGTGGTTGTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.950043
Expected error %
0.910135
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38744.1| Score 86 E Value 3e-30 Identity 59.70% Align. Length 349bp (87.69%) Frame 3
putative gag-pol polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAV31171.1| Score 86 E Value 1e-25 Identity 59.70% Align. Length 349bp (87.69%) Frame 3
putative polyprotein [Solanum tuberosum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0173C14
Clone
Clone name
hba-173c14
LE_HBa0173C14
P173C14
Clone type
BAC
Contamination
none
Estimated length
105,549
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found