Clone Read LE_HBa0173E01_T7_105025

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0173E01_T7_105025
Primer
T7
ID from Seq. Facility
LE_HBa_173_E01-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
704 trimmed for vector and quality, 781 raw
Sequence
>LE_HBa0173E01_T7_105025 (raw untrimmed)
GCCTCGGTCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCCTTTTGAGTTTTTAAAAATACTTTTAGTGGCAATTTCAATTATTTTTGTT
TCTTTCAAGATCTTTAATCCATCTAATATAGTAAAATTGCATTAATACTCTAATTTATTGATATTTGTAATCATCATAAAATTCAAATTAAAGATTTGTT
AAATCTTAGTAAATAATGACTTGGAACAAAATTTTAGAAATTAATTAAATAAAAATAATTAAGCAATATATTATTTAAGACTCCCAACAAATACACTATA
CAGTGATAACATATTAAATTGTACACATTGTTTTTCATCTATAAATAATATAATCATAAGAAACTATAAAAAATAAATCAATTAATGAAAATTATAAAAA
TCAGTCTTTCAAAGAAACCAATTTTCTTTCTTTCATACCTCATGAATCTTGCTAATGTTGATGATGGAAACGGTAACCTTCATATATCATCCCACAAAGT
TTGAATTTGGCAATTCTTTGATTCCATTATATATTCATTAAATCTACATTCTTCACCATCTATTATTTCATGCAAATGTTGTTTTAAAGAAAAGGGGAAA
ATGATGAAAAAGAAGTCGAAAAACAAAGATAAAAGAAATCCTACTCAACTGAAACATGTCCATGAGAAAAATGGAAACAATTTTCTTTGATGTTCTTTGG
GATTCCTTTAACAGATTTATTAATAGTATGTATTAAATTAAATTAATCTACATTAAATTACTATAGAAGCTTTTAAAATTC
>LE_HBa0173E01_T7_105025 (trimmed for quality and cloning vector)
AGCTTCCTTTTGAGTTTTTAAAAATACTTTTAGTGGCAATTTCAATTATTTTTGTTTCTTTCAAGATCTTTAATCCATCTAATATAGTAAAATTGCATTA
ATACTCTAATTTATTGATATTTGTAATCATCATAAAATTCAAATTAAAGATTTGTTAAATCTTAGTAAATAATGACTTGGAACAAAATTTTAGAAATTAA
TTAAATAAAAATAATTAAGCAATATATTATTTAAGACTCCCAACAAATACACTATACAGTGATAACATATTAAATTGTACACATTGTTTTTCATCTATAA
ATAATATAATCATAAGAAACTATAAAAAATAAATCAATTAATGAAAATTATAAAAATCAGTCTTTCAAAGAAACCAATTTTCTTTCTTTCATACCTCATG
AATCTTGCTAATGTTGATGATGGAAACGGTAACCTTCATATATCATCCCACAAAGTTTGAATTTGGCAATTCTTTGATTCCATTATATATTCATTAAATC
TACATTCTTCACCATCTATTATTTCATGCAAATGTTGTTTTAAAGAAAAGGGGAAAATGATGAAAAAGAAGTCGAAAAACAAAGATAAAAGAAATCCTAC
TCAACTGAAACATGTCCATGAGAAAAATGGAAACAATTTTCTTTGATGTTCTTTGGGATTCCTTTAACAGATTTATTAATAGTATGTATTAAATTAAATT
AATC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.879935
Expected error %
0.390514
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0173E01
Clone
Clone name
hba-173e1
LE_HBa0173E01
P173E01
Clone type
BAC
Contamination
none
Estimated length
60,186
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found