Clone Read LE_HBa0173H18_SP6_105202

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0173H18_SP6_105202
Primer
SP6
ID from Seq. Facility
LE_HBa_173_H18-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
272 trimmed for vector and quality, 836 raw
Sequence
>LE_HBa0173H18_SP6_105202 (raw untrimmed)
TACCCGGGGGGACCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAGTGCCTAAAATATGTCATCCTCCCTTTAAATAGTGTTTTTTAAGGTTATTATCC
TCTTACTTGCTCTTTTTATGGATTCAGTATTTTTGAGAGTTGTATTAAATATGTTGGATGTGAGAGTGAGTAGTATTTGTTAGTGAGGTAATAGATTGAG
TATACTGAGAAACGTACACCACCACTTCTTGGCTGCCTGGCTGTGAATAAAGAAGTGATTCACCTCCTCCTAATTCTCTTCATACATAATGCCTATACTG
CACATTGCGAAATATGGCCACTTTAGGCGGTGCTTCCTCGTCTGTACTACCCTCCACGGCCGCTGTATGGTGGTACTTTGATTCTTGCTCCGATCGTTTC
CCCTATTTCACAATGTGCTCCCTTCGATTCTGATTTTCTGATCCAACAGCTCTGCTTCCCTCTTCTACACTTGCGAAAATTCTTTCCTTCTCGCCCCTTG
CCCACTTACTTCTCCTTTGACTTTCTTTTACGCCCTTCCATTTCTTCGCTCTCTATCTCCTTCTTCTAATTTGCTCCTTCCTCTCTCCTCACTCTCCTCT
CTCCTCTTTATCTCTCCCTTATTTCTTTTGCTTTCTTTCTTCCTATCTTTTTCTTCGTTTTATGTCTCTCCTCTGTTTCTTCGCTCATTCTCCTCGGCTC
CCGGGTTTGACGCTCTTACTATCTCTCCTCACTCACCTCTCACGCTCTGCGCTCCCTCTCTCCTTTCCTTCTTCTCTTCATTTCTTCCCCCCGATTCTCT
CTCTTCTTCTCCCCTTGCCTTATTCCCTCTCCTCCC
>LE_HBa0173H18_SP6_105202 (trimmed for quality and cloning vector)
AGCTTAGTGCCTAAAATATGTCATCCTCCCTTTAAATAGTGTTTTTTAAGGTTATTATCCTCTTACTTGCTCTTTTTATGGATTCAGTATTTTTGAGAGT
TGTATTAAATATGTTGGATGTGAGAGTGAGTAGTATTTGTTAGTGAGGTAATAGATTGAGTATACTGAGAAACGTACACCACCACTTCTTGGCTGCCTGG
CTGTGAATAAAGAAGTGATTCACCTCCTCCTAATTCTCTTCATACATAATGCCTATACTGCACATTGCGAAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.948483
Expected error %
1.20126
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0173H18
Clone
Clone name
hba-173h18
LE_HBa0173H18
P173H18
Clone type
BAC
Contamination
none
Estimated length
94,980
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found