Clone Read LE_HBa0173M07_T7_105421

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0173M07_T7_105421
Primer
T7
ID from Seq. Facility
LE_HBa_173_M07-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
733 trimmed for vector and quality, 801 raw
Sequence
>LE_HBa0173M07_T7_105421 (raw untrimmed)
ACTCGGAACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTATATTTACCTGCTTCTACCACCGTTTAGGGACCAGAATCAGTAGAAACCTG
AGACTCTCGACCCTATTAAGCAAAAGTGTGTTTAAATTTCTGAAACAACACAATTTTAGCAAATGTTTACAAACTGTTCGACAATATGCCTGAAAGAAGA
AAAAATGAACATCATACAATAGAACTAGTTTACACAGCACGGCACCTGCAAGTAGTATACAAGGGCTTTGAGTTTGAAGCGCGAGAGTAAGACATTTTCT
CTTGTGAAGTTTGATATCGCAGCCATGAAACTTGAGAACTCTACTGTTCTGTATAACAGCAACTGGAGAAGACGGGTCATTTAAGAAGTGAGACCAAAAA
CAATAGTAATCATTGCTTATAGTTAAAAAAAAAAATGAAACGCAATTCGAACTAAACTAAAAAAAAGTTAATATTTGATTTGATTCGGTTATATTTCGTT
TTAAAATTTTGAATACCCATATTATTTAGTTTGGTTTTGATTTTATTAAAACAATAACTGTAAAAATAATCAAATGGAACAATAAATTAGATATATAAAT
TTTATATTATTGATAAATATTTTGTTAAATTTCAAGTAATTCAAGTTTTTAACTTTACATTTTTCTCAAGGCTAACGCTTAAATTTTAGCCTAATTACAA
TCTTAAGTCCAATTTCAGTACAATTTAGTACCTATCAGAACTTTCATATTTTCTCTTAATTTAATAATTTTATTTGTGTAATGATAACTCTAAATATTGG
T
>LE_HBa0173M07_T7_105421 (trimmed for quality and cloning vector)
AGCTTATATTTACCTGCTTCTACCACCGTTTAGGGACCAGAATCAGTAGAAACCTGAGACTCTCGACCCTATTAAGCAAAAGTGTGTTTAAATTTCTGAA
ACAACACAATTTTAGCAAATGTTTACAAACTGTTCGACAATATGCCTGAAAGAAGAAAAAATGAACATCATACAATAGAACTAGTTTACACAGCACGGCA
CCTGCAAGTAGTATACAAGGGCTTTGAGTTTGAAGCGCGAGAGTAAGACATTTTCTCTTGTGAAGTTTGATATCGCAGCCATGAAACTTGAGAACTCTAC
TGTTCTGTATAACAGCAACTGGAGAAGACGGGTCATTTAAGAAGTGAGACCAAAAACAATAGTAATCATTGCTTATAGTTAAAAAAAAAAATGAAACGCA
ATTCGAACTAAACTAAAAAAAAGTTAATATTTGATTTGATTCGGTTATATTTCGTTTTAAAATTTTGAATACCCATATTATTTAGTTTGGTTTTGATTTT
ATTAAAACAATAACTGTAAAAATAATCAAATGGAACAATAAATTAGATATATAAATTTTATATTATTGATAAATATTTTGTTAAATTTCAAGTAATTCAA
GTTTTTAACTTTACATTTTTCTCAAGGCTAACGCTTAAATTTTAGCCTAATTACAATCTTAAGTCCAATTTCAGTACAATTTAGTACCTATCAGAACTTT
CATATTTTCTCTTAATTTAATAATTTTATTTGT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.922539
Expected error %
1.16694
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0173M07
Clone
Clone name
hba-173m7
LE_HBa0173M07
P173M07
Clone type
BAC
Contamination
none
Estimated length
91,283
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found